FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636763_at:

>probe:Drosophila_2:1636763_at:226:271; Interrogation_Position=1010; Antisense; CATGCGGCGTGTGCAGGAAGTCTAC
>probe:Drosophila_2:1636763_at:578:563; Interrogation_Position=1025; Antisense; GGAAGTCTACCAGTACACACATAGT
>probe:Drosophila_2:1636763_at:565:667; Interrogation_Position=1049; Antisense; TACATCTGGGTAACACAGCGCGGCA
>probe:Drosophila_2:1636763_at:706:645; Interrogation_Position=1108; Antisense; TCTTGTTGTGGCGTTTTTCCCTCGA
>probe:Drosophila_2:1636763_at:568:695; Interrogation_Position=1123; Antisense; TTTCCCTCGACTGCCAAATTTATGA
>probe:Drosophila_2:1636763_at:498:393; Interrogation_Position=1174; Antisense; GAAATTCGCTTTCTTTTTAATGTCA
>probe:Drosophila_2:1636763_at:542:707; Interrogation_Position=1199; Antisense; TTAAGGACTTGTTGGCGTTTTCGCT
>probe:Drosophila_2:1636763_at:703:325; Interrogation_Position=1213; Antisense; GCGTTTTCGCTTTTGACGGTCCACA
>probe:Drosophila_2:1636763_at:83:403; Interrogation_Position=693; Antisense; GACTTGGCTCAGTTGCATGCGAACA
>probe:Drosophila_2:1636763_at:122:473; Interrogation_Position=738; Antisense; GTTCATGAGCAATCAACGTCACCGT
>probe:Drosophila_2:1636763_at:658:67; Interrogation_Position=834; Antisense; ATGGCGAGTATCTTTCGCGACTCTG
>probe:Drosophila_2:1636763_at:350:405; Interrogation_Position=852; Antisense; GACTCTGTTCTTCTCTTATTTGACA
>probe:Drosophila_2:1636763_at:149:491; Interrogation_Position=904; Antisense; GTACATTTTCAATTAACGGCAGCGG
>probe:Drosophila_2:1636763_at:555:187; Interrogation_Position=976; Antisense; AACAGGGCTCAGTGCCGCAAGTTTG

Paste this into a BLAST search page for me
CATGCGGCGTGTGCAGGAAGTCTACGGAAGTCTACCAGTACACACATAGTTACATCTGGGTAACACAGCGCGGCATCTTGTTGTGGCGTTTTTCCCTCGATTTCCCTCGACTGCCAAATTTATGAGAAATTCGCTTTCTTTTTAATGTCATTAAGGACTTGTTGGCGTTTTCGCTGCGTTTTCGCTTTTGACGGTCCACAGACTTGGCTCAGTTGCATGCGAACAGTTCATGAGCAATCAACGTCACCGTATGGCGAGTATCTTTCGCGACTCTGGACTCTGTTCTTCTCTTATTTGACAGTACATTTTCAATTAACGGCAGCGGAACAGGGCTCAGTGCCGCAAGTTTG

Full Affymetrix probeset data:

Annotations for 1636763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720