FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636764_at:

>probe:Drosophila_2:1636764_at:499:81; Interrogation_Position=1073; Antisense; AGGGTCCCCAGATCGACGATGACAT
>probe:Drosophila_2:1636764_at:145:137; Interrogation_Position=1088; Antisense; ACGATGACATGCTGACCAAGGTGTT
>probe:Drosophila_2:1636764_at:201:231; Interrogation_Position=1177; Antisense; AATGTCGGTTTCTTCGTTGAGCCCA
>probe:Drosophila_2:1636764_at:67:311; Interrogation_Position=1199; Antisense; CCACTGTCTTCTCGGACGTGAAGGA
>probe:Drosophila_2:1636764_at:326:303; Interrogation_Position=1259; Antisense; CCGTTCAGTCGATCTTCAAGTTCAG
>probe:Drosophila_2:1636764_at:523:653; Interrogation_Position=1274; Antisense; TCAAGTTCAGCTCCCTGGAGGAGAT
>probe:Drosophila_2:1636764_at:278:437; Interrogation_Position=1291; Antisense; GAGGAGATGATCGATCGGGCCAACA
>probe:Drosophila_2:1636764_at:446:161; Interrogation_Position=1313; Antisense; ACAATGTGCAATATGGCCTGGCCGC
>probe:Drosophila_2:1636764_at:587:317; Interrogation_Position=1336; Antisense; GCCGGCGTTATTACCAATGACATCA
>probe:Drosophila_2:1636764_at:27:49; Interrogation_Position=1391; Antisense; ATGCCGGCTCCGTGTGGATCAACTG
>probe:Drosophila_2:1636764_at:179:455; Interrogation_Position=1407; Antisense; GATCAACTGCTATGATGCCGTGCTG
>probe:Drosophila_2:1636764_at:198:545; Interrogation_Position=1450; Antisense; GGATACAAGCACTCTGGCATTGGCA
>probe:Drosophila_2:1636764_at:502:723; Interrogation_Position=1551; Antisense; TTGAAGTGTTTCCTGTCTCGTATAC
>probe:Drosophila_2:1636764_at:306:9; Interrogation_Position=1592; Antisense; ATTCGCACTTGTTTTCGGTTTTATG

Paste this into a BLAST search page for me
AGGGTCCCCAGATCGACGATGACATACGATGACATGCTGACCAAGGTGTTAATGTCGGTTTCTTCGTTGAGCCCACCACTGTCTTCTCGGACGTGAAGGACCGTTCAGTCGATCTTCAAGTTCAGTCAAGTTCAGCTCCCTGGAGGAGATGAGGAGATGATCGATCGGGCCAACAACAATGTGCAATATGGCCTGGCCGCGCCGGCGTTATTACCAATGACATCAATGCCGGCTCCGTGTGGATCAACTGGATCAACTGCTATGATGCCGTGCTGGGATACAAGCACTCTGGCATTGGCATTGAAGTGTTTCCTGTCTCGTATACATTCGCACTTGTTTTCGGTTTTATG

Full Affymetrix probeset data:

Annotations for 1636764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720