Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636765_at:

>probe:Drosophila_2:1636765_at:355:99; Interrogation_Position=1365; Antisense; AGAGGCTCAAGGTTCTGTTGCGTAC
>probe:Drosophila_2:1636765_at:348:603; Interrogation_Position=1380; Antisense; TGTTGCGTACTACTCGTACATCACC
>probe:Drosophila_2:1636765_at:416:663; Interrogation_Position=1396; Antisense; TACATCACCGGTTTTCGAGGGAGCC
>probe:Drosophila_2:1636765_at:212:99; Interrogation_Position=1437; Antisense; AGAGTTCTCCTTCACTCGAAACAAG
>probe:Drosophila_2:1636765_at:500:103; Interrogation_Position=1460; Antisense; AGACCTCGGGATTGAAAACTTATTG
>probe:Drosophila_2:1636765_at:318:177; Interrogation_Position=1475; Antisense; AAACTTATTGGTCTTGCGCTCGAGC
>probe:Drosophila_2:1636765_at:437:323; Interrogation_Position=1490; Antisense; GCGCTCGAGCGGGTGTTCACAAATG
>probe:Drosophila_2:1636765_at:483:513; Interrogation_Position=1502; Antisense; GTGTTCACAAATGCAAGGCCCGTGT
>probe:Drosophila_2:1636765_at:454:227; Interrogation_Position=1516; Antisense; AAGGCCCGTGTAGTCACCGCGCAAG
>probe:Drosophila_2:1636765_at:182:133; Interrogation_Position=1531; Antisense; ACCGCGCAAGACCACGATGTGACTA
>probe:Drosophila_2:1636765_at:604:441; Interrogation_Position=1546; Antisense; GATGTGACTATCAAATGCGGACAAC
>probe:Drosophila_2:1636765_at:716:307; Interrogation_Position=1575; Antisense; CCATCCGCCCTACTAAAGAATCATA
>probe:Drosophila_2:1636765_at:59:367; Interrogation_Position=1592; Antisense; GAATCATATTAAAACCGGCCGACTT
>probe:Drosophila_2:1636765_at:241:131; Interrogation_Position=1605; Antisense; ACCGGCCGACTTTGGATCATTGTAT

Paste this into a BLAST search page for me
AGAGGCTCAAGGTTCTGTTGCGTACTGTTGCGTACTACTCGTACATCACCTACATCACCGGTTTTCGAGGGAGCCAGAGTTCTCCTTCACTCGAAACAAGAGACCTCGGGATTGAAAACTTATTGAAACTTATTGGTCTTGCGCTCGAGCGCGCTCGAGCGGGTGTTCACAAATGGTGTTCACAAATGCAAGGCCCGTGTAAGGCCCGTGTAGTCACCGCGCAAGACCGCGCAAGACCACGATGTGACTAGATGTGACTATCAAATGCGGACAACCCATCCGCCCTACTAAAGAATCATAGAATCATATTAAAACCGGCCGACTTACCGGCCGACTTTGGATCATTGTAT

Full Affymetrix probeset data:

Annotations for 1636765_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime