FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636767_at:

>probe:Drosophila_2:1636767_at:55:471; Interrogation_Position=100; Antisense; GTTCCCTAGCCAGGGAGATGTCCAA
>probe:Drosophila_2:1636767_at:27:195; Interrogation_Position=213; Antisense; AACTCCAACGGATCCAATGACTACG
>probe:Drosophila_2:1636767_at:394:231; Interrogation_Position=228; Antisense; AATGACTACGGCATCTTTCAGATCA
>probe:Drosophila_2:1636767_at:700:253; Interrogation_Position=251; Antisense; CAACAACAAGTACTGGTGCAAGCCG
>probe:Drosophila_2:1636767_at:134:411; Interrogation_Position=333; Antisense; GACGACATCACCAATTCCGTGAAGT
>probe:Drosophila_2:1636767_at:223:243; Interrogation_Position=345; Antisense; AATTCCGTGAAGTGCGCCCGGAAGA
>probe:Drosophila_2:1636767_at:217:629; Interrogation_Position=370; Antisense; TCCAGCGCCAGCAGGGATGGACTGC
>probe:Drosophila_2:1636767_at:292:441; Interrogation_Position=385; Antisense; GATGGACTGCTTGGTCCACATGGAA
>probe:Drosophila_2:1636767_at:22:67; Interrogation_Position=404; Antisense; ATGGAAGTACTGCAGCGGATCCCTG
>probe:Drosophila_2:1636767_at:276:455; Interrogation_Position=434; Antisense; GATCAACAGTTGCTTCTAGTCTCGC
>probe:Drosophila_2:1636767_at:48:483; Interrogation_Position=560; Antisense; GTATCTGTGAGCTGAAGACATCTTA
>probe:Drosophila_2:1636767_at:55:21; Interrogation_Position=626; Antisense; ATATAACTCCTCGTTGACTTTTTCG
>probe:Drosophila_2:1636767_at:634:403; Interrogation_Position=641; Antisense; GACTTTTTCGATATTCATGCACTTT
>probe:Drosophila_2:1636767_at:510:353; Interrogation_Position=659; Antisense; GCACTTTAAGACTCATATTTCTCGA

Paste this into a BLAST search page for me
GTTCCCTAGCCAGGGAGATGTCCAAAACTCCAACGGATCCAATGACTACGAATGACTACGGCATCTTTCAGATCACAACAACAAGTACTGGTGCAAGCCGGACGACATCACCAATTCCGTGAAGTAATTCCGTGAAGTGCGCCCGGAAGATCCAGCGCCAGCAGGGATGGACTGCGATGGACTGCTTGGTCCACATGGAAATGGAAGTACTGCAGCGGATCCCTGGATCAACAGTTGCTTCTAGTCTCGCGTATCTGTGAGCTGAAGACATCTTAATATAACTCCTCGTTGACTTTTTCGGACTTTTTCGATATTCATGCACTTTGCACTTTAAGACTCATATTTCTCGA

Full Affymetrix probeset data:

Annotations for 1636767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720