Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636769_at:

>probe:Drosophila_2:1636769_at:463:527; Interrogation_Position=1819; Antisense; GGGAGCTACTTCATGGCTATTTCAA
>probe:Drosophila_2:1636769_at:576:347; Interrogation_Position=1916; Antisense; GCAGGGAAACCATCGCAAGCTCAAA
>probe:Drosophila_2:1636769_at:220:235; Interrogation_Position=1994; Antisense; AATGCCTGGGCACGTTGTCGAGATC
>probe:Drosophila_2:1636769_at:659:695; Interrogation_Position=2019; Antisense; TTTCCCTCCTTCAGCAACTAGATGA
>probe:Drosophila_2:1636769_at:63:679; Interrogation_Position=2037; Antisense; TAGATGACCGCTTTCATTGCGCAAA
>probe:Drosophila_2:1636769_at:718:169; Interrogation_Position=2071; Antisense; AAAGGTTGGTCACATCGTGCGTCAG
>probe:Drosophila_2:1636769_at:73:627; Interrogation_Position=2132; Antisense; TCGTCAACCTCCTTTTGTAAACGCA
>probe:Drosophila_2:1636769_at:667:353; Interrogation_Position=2154; Antisense; GCACCCTGCCCGAATATTTAATGAT
>probe:Drosophila_2:1636769_at:388:489; Interrogation_Position=2201; Antisense; GTACTGACTCTAACCCGCAAATGTT
>probe:Drosophila_2:1636769_at:496:555; Interrogation_Position=2227; Antisense; GGACGTATTTGCACAACCACTCATT
>probe:Drosophila_2:1636769_at:406:709; Interrogation_Position=2262; Antisense; TTAAGCCGGATACACATCATCTCTC
>probe:Drosophila_2:1636769_at:476:217; Interrogation_Position=2290; Antisense; AAGTGCTTAGCCCAGTTTTATTGTT
>probe:Drosophila_2:1636769_at:427:165; Interrogation_Position=2346; Antisense; AAATCAGGTGATCGCATGGCCGTGA
>probe:Drosophila_2:1636769_at:578:85; Interrogation_Position=2382; Antisense; AGTCGGGTTCAAAAGTCTCTCCGCT

Paste this into a BLAST search page for me
GGGAGCTACTTCATGGCTATTTCAAGCAGGGAAACCATCGCAAGCTCAAAAATGCCTGGGCACGTTGTCGAGATCTTTCCCTCCTTCAGCAACTAGATGATAGATGACCGCTTTCATTGCGCAAAAAAGGTTGGTCACATCGTGCGTCAGTCGTCAACCTCCTTTTGTAAACGCAGCACCCTGCCCGAATATTTAATGATGTACTGACTCTAACCCGCAAATGTTGGACGTATTTGCACAACCACTCATTTTAAGCCGGATACACATCATCTCTCAAGTGCTTAGCCCAGTTTTATTGTTAAATCAGGTGATCGCATGGCCGTGAAGTCGGGTTCAAAAGTCTCTCCGCT

Full Affymetrix probeset data:

Annotations for 1636769_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime