FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636770_at:

>probe:Drosophila_2:1636770_at:447:157; Interrogation_Position=224; Antisense; ACAAGCCGGAGGTGGAGATCTGTTC
>probe:Drosophila_2:1636770_at:650:109; Interrogation_Position=299; Antisense; AGAAGGTGCTGATCGAGCCGTCCAT
>probe:Drosophila_2:1636770_at:615:271; Interrogation_Position=321; Antisense; CATTAACTCGGTGCGCGTGAGCATC
>probe:Drosophila_2:1636770_at:289:635; Interrogation_Position=344; Antisense; TCGCCGTGAAGCAGGCCGACGAGAT
>probe:Drosophila_2:1636770_at:260:427; Interrogation_Position=364; Antisense; GAGATTGAGCGCATACTGTGCCACA
>probe:Drosophila_2:1636770_at:563:669; Interrogation_Position=377; Antisense; TACTGTGCCACAAGTTCACCAGGTT
>probe:Drosophila_2:1636770_at:129:711; Interrogation_Position=391; Antisense; TTCACCAGGTTCATGATGCGACGCG
>probe:Drosophila_2:1636770_at:388:87; Interrogation_Position=419; Antisense; AGTCGTTCGTCATACTGCGCCGCAA
>probe:Drosophila_2:1636770_at:483:81; Interrogation_Position=452; Antisense; AGGGCTACGACATAAGCTTCCTCAT
>probe:Drosophila_2:1636770_at:25:127; Interrogation_Position=478; Antisense; ACCAACTTCCACACGGAGCAGATGT
>probe:Drosophila_2:1636770_at:114:557; Interrogation_Position=519; Antisense; GGACTTTGTCATTAGCTTCATGGAG
>probe:Drosophila_2:1636770_at:372:289; Interrogation_Position=606; Antisense; CGAGGAGTTCCTCAAACGGTTCTAG
>probe:Drosophila_2:1636770_at:657:225; Interrogation_Position=634; Antisense; AAGGCAACCAGTATGGACCCGGTCA
>probe:Drosophila_2:1636770_at:336:553; Interrogation_Position=648; Antisense; GGACCCGGTCATGATGCTTTAGTAT

Paste this into a BLAST search page for me
ACAAGCCGGAGGTGGAGATCTGTTCAGAAGGTGCTGATCGAGCCGTCCATCATTAACTCGGTGCGCGTGAGCATCTCGCCGTGAAGCAGGCCGACGAGATGAGATTGAGCGCATACTGTGCCACATACTGTGCCACAAGTTCACCAGGTTTTCACCAGGTTCATGATGCGACGCGAGTCGTTCGTCATACTGCGCCGCAAAGGGCTACGACATAAGCTTCCTCATACCAACTTCCACACGGAGCAGATGTGGACTTTGTCATTAGCTTCATGGAGCGAGGAGTTCCTCAAACGGTTCTAGAAGGCAACCAGTATGGACCCGGTCAGGACCCGGTCATGATGCTTTAGTAT

Full Affymetrix probeset data:

Annotations for 1636770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720