FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636771_at:

>probe:Drosophila_2:1636771_at:76:107; Interrogation_Position=1569; Antisense; AGAAGAGGAGTTGTACGCGTGTAAA
>probe:Drosophila_2:1636771_at:46:701; Interrogation_Position=1623; Antisense; TTTTTCGTGACATTACCTAGCATAT
>probe:Drosophila_2:1636771_at:598:263; Interrogation_Position=1680; Antisense; CAGCTACCCCAGCTAATACAATCTG
>probe:Drosophila_2:1636771_at:710:161; Interrogation_Position=1697; Antisense; ACAATCTGGAATATCACCCATCCGG
>probe:Drosophila_2:1636771_at:233:149; Interrogation_Position=1729; Antisense; ACTTCGGCACTTCGGCAGGGAGTTT
>probe:Drosophila_2:1636771_at:555:549; Interrogation_Position=1747; Antisense; GGAGTTTCTGTTAGGCCAGCAGCAT
>probe:Drosophila_2:1636771_at:5:705; Interrogation_Position=1779; Antisense; TTATGGTGTAGCCAACACCTGGCCA
>probe:Drosophila_2:1636771_at:575:131; Interrogation_Position=1795; Antisense; ACCTGGCCACCATTGTAAACATACA
>probe:Drosophila_2:1636771_at:446:339; Interrogation_Position=1825; Antisense; GCTAGCAAGCGGTATCCACATTGGA
>probe:Drosophila_2:1636771_at:322:617; Interrogation_Position=1876; Antisense; TGCATGTTGTGGCAGACGAAACTCA
>probe:Drosophila_2:1636771_at:142:687; Interrogation_Position=1987; Antisense; TATACACTGGCCTATGAAACTCGAT
>probe:Drosophila_2:1636771_at:126:391; Interrogation_Position=2002; Antisense; GAAACTCGATTTCTCTGTTCTTAGT
>probe:Drosophila_2:1636771_at:680:369; Interrogation_Position=2044; Antisense; GAAGTTTGTACATCTCGGATTCGGA
>probe:Drosophila_2:1636771_at:293:57; Interrogation_Position=2079; Antisense; ATGAGTCGCTGTCCAACGAGTTGTT

Paste this into a BLAST search page for me
AGAAGAGGAGTTGTACGCGTGTAAATTTTTCGTGACATTACCTAGCATATCAGCTACCCCAGCTAATACAATCTGACAATCTGGAATATCACCCATCCGGACTTCGGCACTTCGGCAGGGAGTTTGGAGTTTCTGTTAGGCCAGCAGCATTTATGGTGTAGCCAACACCTGGCCAACCTGGCCACCATTGTAAACATACAGCTAGCAAGCGGTATCCACATTGGATGCATGTTGTGGCAGACGAAACTCATATACACTGGCCTATGAAACTCGATGAAACTCGATTTCTCTGTTCTTAGTGAAGTTTGTACATCTCGGATTCGGAATGAGTCGCTGTCCAACGAGTTGTT

Full Affymetrix probeset data:

Annotations for 1636771_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720