Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636774_at:

>probe:Drosophila_2:1636774_at:545:587; Interrogation_Position=3927; Antisense; TGGGTGGCCAAAAACTTCTCCGCAA
>probe:Drosophila_2:1636774_at:548:71; Interrogation_Position=3951; Antisense; AGGCGGATTATCACCTGGGTCAGGT
>probe:Drosophila_2:1636774_at:13:61; Interrogation_Position=3986; Antisense; ATGTTTCGGGTGCAGTGCCATCAAA
>probe:Drosophila_2:1636774_at:246:171; Interrogation_Position=4009; Antisense; AAAGGGATTGCATCAGCGACAACCC
>probe:Drosophila_2:1636774_at:459:419; Interrogation_Position=4080; Antisense; GAGCTTTGGGATATTGCTTGCCCCT
>probe:Drosophila_2:1636774_at:277:469; Interrogation_Position=4135; Antisense; GTTGCAGAATGTGCTCCTTTCCTAT
>probe:Drosophila_2:1636774_at:269:717; Interrogation_Position=4153; Antisense; TTCCTATCAGGAACACCTTTGCGGC
>probe:Drosophila_2:1636774_at:141:695; Interrogation_Position=4170; Antisense; TTTGCGGCCTCAATCCCAAGGAATA
>probe:Drosophila_2:1636774_at:140:225; Interrogation_Position=4187; Antisense; AAGGAATACCGCACTCTCAAGTCAT
>probe:Drosophila_2:1636774_at:497:105; Interrogation_Position=4215; Antisense; AGAAACAAGGCATCAACCCGTCTCG
>probe:Drosophila_2:1636774_at:705:291; Interrogation_Position=4233; Antisense; CGTCTCGCTGCATCATTGACGGAGA
>probe:Drosophila_2:1636774_at:163:405; Interrogation_Position=4275; Antisense; GACTAATGGCCAATTCGGAACGCAA
>probe:Drosophila_2:1636774_at:350:729; Interrogation_Position=4317; Antisense; TTGGCACGCGCACTGAAGAAATCTT
>probe:Drosophila_2:1636774_at:89:125; Interrogation_Position=4369; Antisense; AGCCAGCGTTTTTTAGACATCCTAT

Paste this into a BLAST search page for me
TGGGTGGCCAAAAACTTCTCCGCAAAGGCGGATTATCACCTGGGTCAGGTATGTTTCGGGTGCAGTGCCATCAAAAAAGGGATTGCATCAGCGACAACCCGAGCTTTGGGATATTGCTTGCCCCTGTTGCAGAATGTGCTCCTTTCCTATTTCCTATCAGGAACACCTTTGCGGCTTTGCGGCCTCAATCCCAAGGAATAAAGGAATACCGCACTCTCAAGTCATAGAAACAAGGCATCAACCCGTCTCGCGTCTCGCTGCATCATTGACGGAGAGACTAATGGCCAATTCGGAACGCAATTGGCACGCGCACTGAAGAAATCTTAGCCAGCGTTTTTTAGACATCCTAT

Full Affymetrix probeset data:

Annotations for 1636774_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime