Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636777_at:

>probe:Drosophila_2:1636777_at:600:679; Interrogation_Position=111; Antisense; TAGTGCACACACTTCAGTTGTTGAA
>probe:Drosophila_2:1636777_at:250:649; Interrogation_Position=124; Antisense; TCAGTTGTTGAAAGCGCCGGCGACA
>probe:Drosophila_2:1636777_at:228:401; Interrogation_Position=209; Antisense; GAGCCTGTGAAACAAACCCTTGAAA
>probe:Drosophila_2:1636777_at:134:395; Interrogation_Position=230; Antisense; GAAATGGGCCATCGCTTGGGATTCC
>probe:Drosophila_2:1636777_at:86:529; Interrogation_Position=247; Antisense; GGGATTCCTGCAGAAACTCGACGGT
>probe:Drosophila_2:1636777_at:411:1; Interrogation_Position=262; Antisense; ACTCGACGGTCGCTACTTTTTGATG
>probe:Drosophila_2:1636777_at:174:63; Interrogation_Position=288; Antisense; ATGTGACCTTCGAGACATTGATGTC
>probe:Drosophila_2:1636777_at:226:607; Interrogation_Position=306; Antisense; TGATGTCTGAGATGGAGGCCCTTGA
>probe:Drosophila_2:1636777_at:665:365; Interrogation_Position=338; Antisense; GAATCTCCGGAGAAGTCACTTAAAA
>probe:Drosophila_2:1636777_at:527:239; Interrogation_Position=376; Antisense; AATACCCAAGACTCCTTTATCGTCG
>probe:Drosophila_2:1636777_at:195:307; Interrogation_Position=389; Antisense; CCTTTATCGTCGGTCGCTGAGAAAA
>probe:Drosophila_2:1636777_at:551:611; Interrogation_Position=475; Antisense; TGAAAAGGGCCGACTGCAGGACATT
>probe:Drosophila_2:1636777_at:460:557; Interrogation_Position=493; Antisense; GGACATTCCTAGTTCATCCACAAAC
>probe:Drosophila_2:1636777_at:474:389; Interrogation_Position=522; Antisense; GAAAAACGCCATCCAAGCTGATTAA

Paste this into a BLAST search page for me
TAGTGCACACACTTCAGTTGTTGAATCAGTTGTTGAAAGCGCCGGCGACAGAGCCTGTGAAACAAACCCTTGAAAGAAATGGGCCATCGCTTGGGATTCCGGGATTCCTGCAGAAACTCGACGGTACTCGACGGTCGCTACTTTTTGATGATGTGACCTTCGAGACATTGATGTCTGATGTCTGAGATGGAGGCCCTTGAGAATCTCCGGAGAAGTCACTTAAAAAATACCCAAGACTCCTTTATCGTCGCCTTTATCGTCGGTCGCTGAGAAAATGAAAAGGGCCGACTGCAGGACATTGGACATTCCTAGTTCATCCACAAACGAAAAACGCCATCCAAGCTGATTAA

Full Affymetrix probeset data:

Annotations for 1636777_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime