FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636778_at:

>probe:Drosophila_2:1636778_at:687:587; Interrogation_Position=14; Antisense; TGGAGCAACAACGTCTTCAACTGGC
>probe:Drosophila_2:1636778_at:457:111; Interrogation_Position=17; Antisense; AGCAACAACGTCTTCAACTGGCCAG
>probe:Drosophila_2:1636778_at:215:187; Interrogation_Position=20; Antisense; AACAACGTCTTCAACTGGCCAGTAA
>probe:Drosophila_2:1636778_at:654:195; Interrogation_Position=23; Antisense; AACGTCTTCAACTGGCCAGTAAGTT
>probe:Drosophila_2:1636778_at:248:197; Interrogation_Position=32; Antisense; AACTGGCCAGTAAGTTGGATCGGAG
>probe:Drosophila_2:1636778_at:593:313; Interrogation_Position=37; Antisense; GCCAGTAAGTTGGATCGGAGTCAAA
>probe:Drosophila_2:1636778_at:487:549; Interrogation_Position=53; Antisense; GGAGTCAAAGACGTTGTGCTGCCAT
>probe:Drosophila_2:1636778_at:599:171; Interrogation_Position=59; Antisense; AAAGACGTTGTGCTGCCATGTCGAC
>probe:Drosophila_2:1636778_at:136:103; Interrogation_Position=61; Antisense; AGACGTTGTGCTGCCATGTCGACGA
>probe:Drosophila_2:1636778_at:519:467; Interrogation_Position=65; Antisense; GTTGTGCTGCCATGTCGACGACGAC
>probe:Drosophila_2:1636778_at:309:597; Interrogation_Position=67; Antisense; TGTGCTGCCATGTCGACGACGACAG
>probe:Drosophila_2:1636778_at:364:409; Interrogation_Position=81; Antisense; GACGACGACAGCTGCATGTATCGCC
>probe:Drosophila_2:1636778_at:279:137; Interrogation_Position=85; Antisense; ACGACAGCTGCATGTATCGCCGTCT
>probe:Drosophila_2:1636778_at:309:119; Interrogation_Position=90; Antisense; AGCTGCATGTATCGCCGTCTGCTTC

Paste this into a BLAST search page for me
TGGAGCAACAACGTCTTCAACTGGCAGCAACAACGTCTTCAACTGGCCAGAACAACGTCTTCAACTGGCCAGTAAAACGTCTTCAACTGGCCAGTAAGTTAACTGGCCAGTAAGTTGGATCGGAGGCCAGTAAGTTGGATCGGAGTCAAAGGAGTCAAAGACGTTGTGCTGCCATAAAGACGTTGTGCTGCCATGTCGACAGACGTTGTGCTGCCATGTCGACGAGTTGTGCTGCCATGTCGACGACGACTGTGCTGCCATGTCGACGACGACAGGACGACGACAGCTGCATGTATCGCCACGACAGCTGCATGTATCGCCGTCTAGCTGCATGTATCGCCGTCTGCTTC

Full Affymetrix probeset data:

Annotations for 1636778_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720