FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636780_at:

>probe:Drosophila_2:1636780_at:473:77; Interrogation_Position=1950; Antisense; AGGATGCCGCCATTGAGGTGCCAGA
>probe:Drosophila_2:1636780_at:489:141; Interrogation_Position=1977; Antisense; ACGGCGATAGCGGTGACGATGTTCA
>probe:Drosophila_2:1636780_at:621:119; Interrogation_Position=2022; Antisense; AGCTGACACCAAAGGCTGGCGGCGA
>probe:Drosophila_2:1636780_at:693:31; Interrogation_Position=2078; Antisense; ATAATGCATCCACTACTCGCTAGAT
>probe:Drosophila_2:1636780_at:134:447; Interrogation_Position=2100; Antisense; GATCTACTTAAGACTTCTACCTACA
>probe:Drosophila_2:1636780_at:363:415; Interrogation_Position=2202; Antisense; GAGCCATGTCTCGAATTTCAGTTGA
>probe:Drosophila_2:1636780_at:347:427; Interrogation_Position=2225; Antisense; GAGATTGCCATTTTTACTTAGAGAG
>probe:Drosophila_2:1636780_at:290:415; Interrogation_Position=2247; Antisense; GAGCCTACACAAGTGCTTAGCGGAC
>probe:Drosophila_2:1636780_at:488:59; Interrogation_Position=2290; Antisense; ATGTTGAATATTAAGCGCCGCAATT
>probe:Drosophila_2:1636780_at:714:685; Interrogation_Position=2352; Antisense; TTTAGTTAGGCGGAATCCCACCAGC
>probe:Drosophila_2:1636780_at:137:635; Interrogation_Position=2367; Antisense; TCCCACCAGCGGATGCCGAATGAAT
>probe:Drosophila_2:1636780_at:119:369; Interrogation_Position=2384; Antisense; GAATGAATCTCAACAGAGCCGGATT
>probe:Drosophila_2:1636780_at:38:319; Interrogation_Position=2401; Antisense; GCCGGATTCACACCGCTACGATAAT
>probe:Drosophila_2:1636780_at:140:669; Interrogation_Position=2417; Antisense; TACGATAATCTAGTTGGAGCTGCAA

Paste this into a BLAST search page for me
AGGATGCCGCCATTGAGGTGCCAGAACGGCGATAGCGGTGACGATGTTCAAGCTGACACCAAAGGCTGGCGGCGAATAATGCATCCACTACTCGCTAGATGATCTACTTAAGACTTCTACCTACAGAGCCATGTCTCGAATTTCAGTTGAGAGATTGCCATTTTTACTTAGAGAGGAGCCTACACAAGTGCTTAGCGGACATGTTGAATATTAAGCGCCGCAATTTTTAGTTAGGCGGAATCCCACCAGCTCCCACCAGCGGATGCCGAATGAATGAATGAATCTCAACAGAGCCGGATTGCCGGATTCACACCGCTACGATAATTACGATAATCTAGTTGGAGCTGCAA

Full Affymetrix probeset data:

Annotations for 1636780_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720