Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636781_at:

>probe:Drosophila_2:1636781_at:314:639; Interrogation_Position=2340; Antisense; TCGTGGCCCTGCAGCAAACGTACAA
>probe:Drosophila_2:1636781_at:311:207; Interrogation_Position=2363; Antisense; AAGCTGTGCGATGTCTACGGCACCA
>probe:Drosophila_2:1636781_at:203:171; Interrogation_Position=2395; Antisense; AAAGTTCTCCGTGCGATTGGTGCAT
>probe:Drosophila_2:1636781_at:216:37; Interrogation_Position=2432; Antisense; ATCATGACCATATTCCTGGCCAGGA
>probe:Drosophila_2:1636781_at:485:59; Interrogation_Position=2456; Antisense; ATGTTCTTCTTCTACCAGGGTAACT
>probe:Drosophila_2:1636781_at:539:383; Interrogation_Position=2501; Antisense; GACCTAACGCCTGGTTATATCGGAC
>probe:Drosophila_2:1636781_at:22:397; Interrogation_Position=2527; Antisense; GACAAACTACAACCCGTCGATCGTT
>probe:Drosophila_2:1636781_at:711:691; Interrogation_Position=2558; Antisense; TTTGTCACCCTCAACACGTACAGTG
>probe:Drosophila_2:1636781_at:453:623; Interrogation_Position=2581; Antisense; TGCGGATATTCATGCATTCCTCTAT
>probe:Drosophila_2:1636781_at:651:343; Interrogation_Position=2594; Antisense; GCATTCCTCTATTTAGTTGTCCACA
>probe:Drosophila_2:1636781_at:296:349; Interrogation_Position=2637; Antisense; GCAGTGTGGGTATCATGCAGCTACA
>probe:Drosophila_2:1636781_at:199:457; Interrogation_Position=2674; Antisense; GATAGCCGCGGATTCGCTGATAGCT
>probe:Drosophila_2:1636781_at:144:699; Interrogation_Position=2805; Antisense; TTTACGACTGTTACACTGTGCTGGT
>probe:Drosophila_2:1636781_at:534:285; Interrogation_Position=2820; Antisense; CTGTGCTGGTGTTCTATTTGGTATT

Paste this into a BLAST search page for me
TCGTGGCCCTGCAGCAAACGTACAAAAGCTGTGCGATGTCTACGGCACCAAAAGTTCTCCGTGCGATTGGTGCATATCATGACCATATTCCTGGCCAGGAATGTTCTTCTTCTACCAGGGTAACTGACCTAACGCCTGGTTATATCGGACGACAAACTACAACCCGTCGATCGTTTTTGTCACCCTCAACACGTACAGTGTGCGGATATTCATGCATTCCTCTATGCATTCCTCTATTTAGTTGTCCACAGCAGTGTGGGTATCATGCAGCTACAGATAGCCGCGGATTCGCTGATAGCTTTTACGACTGTTACACTGTGCTGGTCTGTGCTGGTGTTCTATTTGGTATT

Full Affymetrix probeset data:

Annotations for 1636781_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime