FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636782_at:

>probe:Drosophila_2:1636782_at:542:681; Interrogation_Position=403; Antisense; TATCCTGCTCCTGTTGCGGGAACAG
>probe:Drosophila_2:1636782_at:255:171; Interrogation_Position=423; Antisense; AACAGCAGCTGGCATTTACCCGTAC
>probe:Drosophila_2:1636782_at:32:669; Interrogation_Position=445; Antisense; TACCCTGGACCCATTGTGGTGCAGA
>probe:Drosophila_2:1636782_at:149:507; Interrogation_Position=490; Antisense; GTGCCCACTAATACCGCAGGACAAT
>probe:Drosophila_2:1636782_at:507:193; Interrogation_Position=553; Antisense; AACTCCTCGAATCCACTGATGACAT
>probe:Drosophila_2:1636782_at:282:55; Interrogation_Position=571; Antisense; ATGACATTTGTCTCCAATCTTCTGC
>probe:Drosophila_2:1636782_at:457:593; Interrogation_Position=650; Antisense; TGGGCATCATCCTCTTTGGCGGTGC
>probe:Drosophila_2:1636782_at:684:509; Interrogation_Position=690; Antisense; GTGCAGGATCACTCCAATCTGTGAA
>probe:Drosophila_2:1636782_at:376:163; Interrogation_Position=713; Antisense; AAATACCCGCCCGTGCTGTGAATAT
>probe:Drosophila_2:1636782_at:541:145; Interrogation_Position=790; Antisense; ACTCCGGAACGAGTGCGTCGGGCAA
>probe:Drosophila_2:1636782_at:686:499; Interrogation_Position=806; Antisense; GTCGGGCAACGGAATTCGTGCGCAA
>probe:Drosophila_2:1636782_at:164:623; Interrogation_Position=824; Antisense; TGCGCAACGCCATCCGGAAGTACAA
>probe:Drosophila_2:1636782_at:255:435; Interrogation_Position=877; Antisense; GAGGCGGTGACCGAGTTGACCAACT
>probe:Drosophila_2:1636782_at:383:513; Interrogation_Position=918; Antisense; GTGTAGGTTTAGTGCTGGCTCGTAA

Paste this into a BLAST search page for me
TATCCTGCTCCTGTTGCGGGAACAGAACAGCAGCTGGCATTTACCCGTACTACCCTGGACCCATTGTGGTGCAGAGTGCCCACTAATACCGCAGGACAATAACTCCTCGAATCCACTGATGACATATGACATTTGTCTCCAATCTTCTGCTGGGCATCATCCTCTTTGGCGGTGCGTGCAGGATCACTCCAATCTGTGAAAAATACCCGCCCGTGCTGTGAATATACTCCGGAACGAGTGCGTCGGGCAAGTCGGGCAACGGAATTCGTGCGCAATGCGCAACGCCATCCGGAAGTACAAGAGGCGGTGACCGAGTTGACCAACTGTGTAGGTTTAGTGCTGGCTCGTAA

Full Affymetrix probeset data:

Annotations for 1636782_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720