Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636783_at:

>probe:Drosophila_2:1636783_at:659:573; Interrogation_Position=1548; Antisense; GGCTGGAGTTAATCCCGCCAAGAAA
>probe:Drosophila_2:1636783_at:327:393; Interrogation_Position=1661; Antisense; GAAAGACTTTTCGACGTCAAGCTTA
>probe:Drosophila_2:1636783_at:699:267; Interrogation_Position=1699; Antisense; CAGGCCTCCCATCAGATGTTGGATA
>probe:Drosophila_2:1636783_at:469:441; Interrogation_Position=1764; Antisense; GTTGACCATCAATGGCCACCAATTG
>probe:Drosophila_2:1636783_at:50:249; Interrogation_Position=1784; Antisense; AATTGGCCGATCATGTCCAGCTGCA
>probe:Drosophila_2:1636783_at:484:665; Interrogation_Position=1812; Antisense; TACAACTGGACAGGCGGTCACATCT
>probe:Drosophila_2:1636783_at:166:597; Interrogation_Position=1883; Antisense; TGTACCCGCCGCCAAGTGGTAAGAA
>probe:Drosophila_2:1636783_at:642:211; Interrogation_Position=1905; Antisense; GAACTATCCGGGTGGACAACGCTTT
>probe:Drosophila_2:1636783_at:465:19; Interrogation_Position=1935; Antisense; ATTTCCCTTTCAGTCATTCGATCAG
>probe:Drosophila_2:1636783_at:203:35; Interrogation_Position=1955; Antisense; ATCAGCGTCGATTCTACTCTCTTGG
>probe:Drosophila_2:1636783_at:211:527; Interrogation_Position=1979; Antisense; GGGAATTTTACCTATCGCAGCACTT
>probe:Drosophila_2:1636783_at:485:111; Interrogation_Position=1997; Antisense; AGCACTTGGAACGATCCTCGGCCTT
>probe:Drosophila_2:1636783_at:476:239; Interrogation_Position=2038; Antisense; AATCACCTGAGGCAACTGTCCAATG
>probe:Drosophila_2:1636783_at:481:229; Interrogation_Position=2059; Antisense; AATGTGGCCCAAACTTTGATGCCTC

Paste this into a BLAST search page for me
GGCTGGAGTTAATCCCGCCAAGAAAGAAAGACTTTTCGACGTCAAGCTTACAGGCCTCCCATCAGATGTTGGATAGTTGACCATCAATGGCCACCAATTGAATTGGCCGATCATGTCCAGCTGCATACAACTGGACAGGCGGTCACATCTTGTACCCGCCGCCAAGTGGTAAGAAGAACTATCCGGGTGGACAACGCTTTATTTCCCTTTCAGTCATTCGATCAGATCAGCGTCGATTCTACTCTCTTGGGGGAATTTTACCTATCGCAGCACTTAGCACTTGGAACGATCCTCGGCCTTAATCACCTGAGGCAACTGTCCAATGAATGTGGCCCAAACTTTGATGCCTC

Full Affymetrix probeset data:

Annotations for 1636783_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime