FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636784_at:

>probe:Drosophila_2:1636784_at:155:183; Interrogation_Position=1025; Antisense; AAAATCGAATTCTCCGCTCGTCTTG
>probe:Drosophila_2:1636784_at:618:421; Interrogation_Position=1049; Antisense; GAGCAAGTTCTTATAGCGATGGGCA
>probe:Drosophila_2:1636784_at:483:447; Interrogation_Position=1079; Antisense; GATGCGTTTAAGACGTCTGCTGACT
>probe:Drosophila_2:1636784_at:486:403; Interrogation_Position=1100; Antisense; GACTTCAATGATCTGGTCGCGAACA
>probe:Drosophila_2:1636784_at:20:51; Interrogation_Position=1141; Antisense; AGGCGTCGTTCACAAGGCGTTCCTA
>probe:Drosophila_2:1636784_at:55:373; Interrogation_Position=1178; Antisense; GAAGGTTCTGAAGCAGCGGCTGCAA
>probe:Drosophila_2:1636784_at:316:669; Interrogation_Position=1230; Antisense; TACGGTCACCGCCAATGGATTTTAA
>probe:Drosophila_2:1636784_at:152:495; Interrogation_Position=1256; Antisense; GTCAATCATCCATTTGCCTATGTCA
>probe:Drosophila_2:1636784_at:41:171; Interrogation_Position=1295; Antisense; AACATTTACTTTCAGGGCCACTTCG
>probe:Drosophila_2:1636784_at:223:309; Interrogation_Position=1311; Antisense; GCCACTTCGTGAACCCGGAACTATA
>probe:Drosophila_2:1636784_at:596:191; Interrogation_Position=861; Antisense; AACTAGGTGCCAATGTTATCGAGCT
>probe:Drosophila_2:1636784_at:50:397; Interrogation_Position=894; Antisense; GAAATTCAAACCTTTCCATGGTCAT
>probe:Drosophila_2:1636784_at:185:267; Interrogation_Position=910; Antisense; CATGGTCATTTTTCTACCGGACAAG
>probe:Drosophila_2:1636784_at:9:231; Interrogation_Position=998; Antisense; AATGTGCATCTAAGGCTTCCCAAGT

Paste this into a BLAST search page for me
AAAATCGAATTCTCCGCTCGTCTTGGAGCAAGTTCTTATAGCGATGGGCAGATGCGTTTAAGACGTCTGCTGACTGACTTCAATGATCTGGTCGCGAACAAGGCGTCGTTCACAAGGCGTTCCTAGAAGGTTCTGAAGCAGCGGCTGCAATACGGTCACCGCCAATGGATTTTAAGTCAATCATCCATTTGCCTATGTCAAACATTTACTTTCAGGGCCACTTCGGCCACTTCGTGAACCCGGAACTATAAACTAGGTGCCAATGTTATCGAGCTGAAATTCAAACCTTTCCATGGTCATCATGGTCATTTTTCTACCGGACAAGAATGTGCATCTAAGGCTTCCCAAGT

Full Affymetrix probeset data:

Annotations for 1636784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720