FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636792_at:

>probe:Drosophila_2:1636792_at:247:261; Interrogation_Position=1017; Antisense; CACGCACCCAAATCTACATATACTA
>probe:Drosophila_2:1636792_at:544:637; Interrogation_Position=1058; Antisense; TCGATGATTGAAGAGCGTCCCAGCT
>probe:Drosophila_2:1636792_at:380:399; Interrogation_Position=1085; Antisense; GACACCACACAATTCATAGCCGATG
>probe:Drosophila_2:1636792_at:162:273; Interrogation_Position=1099; Antisense; CATAGCCGATGTGGGTGGTTCTCTT
>probe:Drosophila_2:1636792_at:5:585; Interrogation_Position=1114; Antisense; TGGTTCTCTTGGTTTTCTACTGGGC
>probe:Drosophila_2:1636792_at:528:277; Interrogation_Position=1130; Antisense; CTACTGGGCTTGTCTGTCCTGGGAT
>probe:Drosophila_2:1636792_at:156:683; Interrogation_Position=1174; Antisense; TATGATGCTCTTTTTCTGTGGCGGA
>probe:Drosophila_2:1636792_at:172:179; Interrogation_Position=1243; Antisense; AAACTCCGAGGATGGTCAATCACAA
>probe:Drosophila_2:1636792_at:681:515; Interrogation_Position=778; Antisense; GTGTGGTGAACAATGCATCTGGCAG
>probe:Drosophila_2:1636792_at:81:237; Interrogation_Position=815; Antisense; AATATGCAGTGTTCGGGTCCTTGGA
>probe:Drosophila_2:1636792_at:5:617; Interrogation_Position=850; Antisense; TGCAAGTGAGCCCTGCAATGACTCC
>probe:Drosophila_2:1636792_at:302:251; Interrogation_Position=865; Antisense; CAATGACTCCCTTTCCATGAGGAAA
>probe:Drosophila_2:1636792_at:29:693; Interrogation_Position=932; Antisense; TTTGACTGTGACTGTGTTCAGCCCT
>probe:Drosophila_2:1636792_at:416:473; Interrogation_Position=947; Antisense; GTTCAGCCCTGCCAATCGAGAATAT

Paste this into a BLAST search page for me
CACGCACCCAAATCTACATATACTATCGATGATTGAAGAGCGTCCCAGCTGACACCACACAATTCATAGCCGATGCATAGCCGATGTGGGTGGTTCTCTTTGGTTCTCTTGGTTTTCTACTGGGCCTACTGGGCTTGTCTGTCCTGGGATTATGATGCTCTTTTTCTGTGGCGGAAAACTCCGAGGATGGTCAATCACAAGTGTGGTGAACAATGCATCTGGCAGAATATGCAGTGTTCGGGTCCTTGGATGCAAGTGAGCCCTGCAATGACTCCCAATGACTCCCTTTCCATGAGGAAATTTGACTGTGACTGTGTTCAGCCCTGTTCAGCCCTGCCAATCGAGAATAT

Full Affymetrix probeset data:

Annotations for 1636792_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720