Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636793_at:

>probe:Drosophila_2:1636793_at:486:165; Interrogation_Position=1005; Antisense; AAATCTCAAGGCATCCGGAGGTCCA
>probe:Drosophila_2:1636793_at:371:393; Interrogation_Position=1074; Antisense; GAAAGAGCCCAGTTACCCTTCGTGA
>probe:Drosophila_2:1636793_at:418:301; Interrogation_Position=1089; Antisense; CCCTTCGTGATCTTGGTGAGCTGAA
>probe:Drosophila_2:1636793_at:76:361; Interrogation_Position=1206; Antisense; GCAAGCATATTCCAGCAGGCACCAA
>probe:Drosophila_2:1636793_at:461:669; Interrogation_Position=1234; Antisense; TACGATGGGCATCTTTGTTCTTCTT
>probe:Drosophila_2:1636793_at:352:603; Interrogation_Position=1249; Antisense; TGTTCTTCTTCGTGATCCTGAGTAC
>probe:Drosophila_2:1636793_at:676:607; Interrogation_Position=1267; Antisense; TGAGTACTTCGAGTCTCCCGATGAG
>probe:Drosophila_2:1636793_at:257:631; Interrogation_Position=1282; Antisense; TCCCGATGAGTTCCGACCTGAAAGA
>probe:Drosophila_2:1636793_at:340:461; Interrogation_Position=1327; Antisense; GATTCATCCGTATGCGTACATTCCT
>probe:Drosophila_2:1636793_at:300:615; Interrogation_Position=1404; Antisense; TGAAGAGCACCGTCAGCAAGCTGCT
>probe:Drosophila_2:1636793_at:349:197; Interrogation_Position=1499; Antisense; AACGGCGTTCATCTTGGCCTGAAAC
>probe:Drosophila_2:1636793_at:110:391; Interrogation_Position=1519; Antisense; GAAACCGCGCGCCTAAGGAATTCAT
>probe:Drosophila_2:1636793_at:177:363; Interrogation_Position=1536; Antisense; GAATTCATTCTTGTGGGTCTATCCA
>probe:Drosophila_2:1636793_at:451:531; Interrogation_Position=1550; Antisense; GGGTCTATCCAGCTCTATTTGCATA

Paste this into a BLAST search page for me
AAATCTCAAGGCATCCGGAGGTCCAGAAAGAGCCCAGTTACCCTTCGTGACCCTTCGTGATCTTGGTGAGCTGAAGCAAGCATATTCCAGCAGGCACCAATACGATGGGCATCTTTGTTCTTCTTTGTTCTTCTTCGTGATCCTGAGTACTGAGTACTTCGAGTCTCCCGATGAGTCCCGATGAGTTCCGACCTGAAAGAGATTCATCCGTATGCGTACATTCCTTGAAGAGCACCGTCAGCAAGCTGCTAACGGCGTTCATCTTGGCCTGAAACGAAACCGCGCGCCTAAGGAATTCATGAATTCATTCTTGTGGGTCTATCCAGGGTCTATCCAGCTCTATTTGCATA

Full Affymetrix probeset data:

Annotations for 1636793_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime