Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636795_at:

>probe:Drosophila_2:1636795_at:87:559; Interrogation_Position=2643; Antisense; GGACATTAAACTGCCATACGCTTTT
>probe:Drosophila_2:1636795_at:58:463; Interrogation_Position=2716; Antisense; GATTCATCGCGCACAACCTTAAAAG
>probe:Drosophila_2:1636795_at:204:99; Interrogation_Position=2756; Antisense; AGATGCGCACGCTGCTGCAGGAGAA
>probe:Drosophila_2:1636795_at:626:93; Interrogation_Position=2821; Antisense; AGTTCCGCGCTCGTGGAGGAGATTC
>probe:Drosophila_2:1636795_at:305:437; Interrogation_Position=2836; Antisense; GAGGAGATTCCTTTGCAACGAGCCA
>probe:Drosophila_2:1636795_at:673:307; Interrogation_Position=2882; Antisense; CCATCCTCGTAATCAGCGTGTGTGA
>probe:Drosophila_2:1636795_at:206:251; Interrogation_Position=2916; Antisense; CAAGGCTCGCTGTTGTGTACCAGAA
>probe:Drosophila_2:1636795_at:628:551; Interrogation_Position=2952; Antisense; GGAGAAATTCAACGCTTCCGCCTGG
>probe:Drosophila_2:1636795_at:526:231; Interrogation_Position=2981; Antisense; AATCCTTTGCCGACACCTTTAATGG
>probe:Drosophila_2:1636795_at:282:229; Interrogation_Position=3001; Antisense; AATGGACAAATAGCCGCGCCCAAGG
>probe:Drosophila_2:1636795_at:616:235; Interrogation_Position=3031; Antisense; AATCCGCAGGCCGTGTGCAACATGA
>probe:Drosophila_2:1636795_at:618:565; Interrogation_Position=3111; Antisense; GGCACATGCATACGCTAAGCTTTAT
>probe:Drosophila_2:1636795_at:271:15; Interrogation_Position=3154; Antisense; ATTACCCTCCAAAATGTGCTAGCTG
>probe:Drosophila_2:1636795_at:694:119; Interrogation_Position=3174; Antisense; AGCTGTAAGCTTGCCCTTTGAATAA

Paste this into a BLAST search page for me
GGACATTAAACTGCCATACGCTTTTGATTCATCGCGCACAACCTTAAAAGAGATGCGCACGCTGCTGCAGGAGAAAGTTCCGCGCTCGTGGAGGAGATTCGAGGAGATTCCTTTGCAACGAGCCACCATCCTCGTAATCAGCGTGTGTGACAAGGCTCGCTGTTGTGTACCAGAAGGAGAAATTCAACGCTTCCGCCTGGAATCCTTTGCCGACACCTTTAATGGAATGGACAAATAGCCGCGCCCAAGGAATCCGCAGGCCGTGTGCAACATGAGGCACATGCATACGCTAAGCTTTATATTACCCTCCAAAATGTGCTAGCTGAGCTGTAAGCTTGCCCTTTGAATAA

Full Affymetrix probeset data:

Annotations for 1636795_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime