FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636797_at:

>probe:Drosophila_2:1636797_at:257:723; Interrogation_Position=1011; Antisense; TTGAGGTAGATCTTTTCCGTCGACT
>probe:Drosophila_2:1636797_at:477:191; Interrogation_Position=1043; Antisense; AACTTTCGGCTGCTGGACATGCCAC
>probe:Drosophila_2:1636797_at:187:489; Interrogation_Position=1099; Antisense; GTACGACATAGAAGCCTGGATGCCA
>probe:Drosophila_2:1636797_at:22:525; Interrogation_Position=1138; Antisense; GGGCGAGATCTCAAGTTGCAGCAAT
>probe:Drosophila_2:1636797_at:166:355; Interrogation_Position=1164; Antisense; GCACGGATTATCAGGCAAGGCGGCT
>probe:Drosophila_2:1636797_at:562:31; Interrogation_Position=1241; Antisense; ATCAACGGAACTGCGACGGCTATTC
>probe:Drosophila_2:1636797_at:39:329; Interrogation_Position=1267; Antisense; GCGTCTGCTGATTGCCTTGCTGGAA
>probe:Drosophila_2:1636797_at:307:43; Interrogation_Position=1313; Antisense; ATCGAGATACCTGCCGTTCTGCGAC
>probe:Drosophila_2:1636797_at:501:471; Interrogation_Position=1328; Antisense; GTTCTGCGACCATTCATGGACAACC
>probe:Drosophila_2:1636797_at:24:537; Interrogation_Position=1396; Antisense; GGTCAAATTCATCAAGGCCTAGGCT
>probe:Drosophila_2:1636797_at:93:71; Interrogation_Position=1410; Antisense; AGGCCTAGGCTTAACACATTCTGTA
>probe:Drosophila_2:1636797_at:476:273; Interrogation_Position=1426; Antisense; CATTCTGTACCTTTGACTGTTATCA
>probe:Drosophila_2:1636797_at:123:21; Interrogation_Position=1485; Antisense; ATATTTTGAAGCACTTCCCGCAGCT
>probe:Drosophila_2:1636797_at:16:169; Interrogation_Position=951; Antisense; AAATGTTTGCCATCTGCACCGAGGA

Paste this into a BLAST search page for me
TTGAGGTAGATCTTTTCCGTCGACTAACTTTCGGCTGCTGGACATGCCACGTACGACATAGAAGCCTGGATGCCAGGGCGAGATCTCAAGTTGCAGCAATGCACGGATTATCAGGCAAGGCGGCTATCAACGGAACTGCGACGGCTATTCGCGTCTGCTGATTGCCTTGCTGGAAATCGAGATACCTGCCGTTCTGCGACGTTCTGCGACCATTCATGGACAACCGGTCAAATTCATCAAGGCCTAGGCTAGGCCTAGGCTTAACACATTCTGTACATTCTGTACCTTTGACTGTTATCAATATTTTGAAGCACTTCCCGCAGCTAAATGTTTGCCATCTGCACCGAGGA

Full Affymetrix probeset data:

Annotations for 1636797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720