FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636798_at:

>probe:Drosophila_2:1636798_at:725:311; Interrogation_Position=21; Antisense; GCCACATCACGAAAATCGCCTGTTT
>probe:Drosophila_2:1636798_at:553:147; Interrogation_Position=24; Antisense; ACATCACGAAAATCGCCTGTTTGGA
>probe:Drosophila_2:1636798_at:227:141; Interrogation_Position=260; Antisense; ACGGCAGCCACTTTGACCATCATCA
>probe:Drosophila_2:1636798_at:492:261; Interrogation_Position=264; Antisense; CAGCCACTTTGACCATCATCATGGT
>probe:Drosophila_2:1636798_at:449:723; Interrogation_Position=272; Antisense; TTGACCATCATCATGGTCCTCACCA
>probe:Drosophila_2:1636798_at:128:37; Interrogation_Position=278; Antisense; ATCATCATGGTCCTCACCATGGACA
>probe:Drosophila_2:1636798_at:724:647; Interrogation_Position=282; Antisense; TCATGGTCCTCACCATGGACATCAT
>probe:Drosophila_2:1636798_at:147:387; Interrogation_Position=31; Antisense; GAAAATCGCCTGTTTGGAATCCACC
>probe:Drosophila_2:1636798_at:467:165; Interrogation_Position=33; Antisense; AAATCGCCTGTTTGGAATCCACCTT
>probe:Drosophila_2:1636798_at:358:43; Interrogation_Position=35; Antisense; ATCGCCTGTTTGGAATCCACCTTGG
>probe:Drosophila_2:1636798_at:162:601; Interrogation_Position=41; Antisense; TGTTTGGAATCCACCTTGGCCTGAA
>probe:Drosophila_2:1636798_at:483:689; Interrogation_Position=43; Antisense; TTTGGAATCCACCTTGGCCTGAATT
>probe:Drosophila_2:1636798_at:475:563; Interrogation_Position=46; Antisense; GGAATCCACCTTGGCCTGAATTTGG
>probe:Drosophila_2:1636798_at:76:45; Interrogation_Position=49; Antisense; ATCCACCTTGGCCTGAATTTGGGTG

Paste this into a BLAST search page for me
GCCACATCACGAAAATCGCCTGTTTACATCACGAAAATCGCCTGTTTGGAACGGCAGCCACTTTGACCATCATCACAGCCACTTTGACCATCATCATGGTTTGACCATCATCATGGTCCTCACCAATCATCATGGTCCTCACCATGGACATCATGGTCCTCACCATGGACATCATGAAAATCGCCTGTTTGGAATCCACCAAATCGCCTGTTTGGAATCCACCTTATCGCCTGTTTGGAATCCACCTTGGTGTTTGGAATCCACCTTGGCCTGAATTTGGAATCCACCTTGGCCTGAATTGGAATCCACCTTGGCCTGAATTTGGATCCACCTTGGCCTGAATTTGGGTG

Full Affymetrix probeset data:

Annotations for 1636798_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720