FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636800_at:

>probe:Drosophila_2:1636800_at:171:369; Interrogation_Position=1679; Antisense; GAATGCACACCCTCATAGTCGCGTG
>probe:Drosophila_2:1636800_at:264:207; Interrogation_Position=1717; Antisense; AAGCTGGCCATCACGGCGTCGTATG
>probe:Drosophila_2:1636800_at:21:585; Interrogation_Position=1740; Antisense; TGGAACCGTTTACATATTCTCCGCC
>probe:Drosophila_2:1636800_at:107:421; Interrogation_Position=1765; Antisense; GAGCAGTTCCCAACCGTGGTTAGAA
>probe:Drosophila_2:1636800_at:19:37; Interrogation_Position=1825; Antisense; ATCAGTGGCATGATGGCACCGTTCC
>probe:Drosophila_2:1636800_at:310:39; Interrogation_Position=1891; Antisense; ATCTGCGGATCCCTGACCTTGGTAG
>probe:Drosophila_2:1636800_at:301:425; Interrogation_Position=1942; Antisense; GAGACGCACAATAAGCCCATGCTGG
>probe:Drosophila_2:1636800_at:242:69; Interrogation_Position=1979; Antisense; ATGGCGAGCGCTTTGGCAAGAAGAC
>probe:Drosophila_2:1636800_at:663:75; Interrogation_Position=2010; Antisense; AGATGTCTACCTGGAAACGGGCCAA
>probe:Drosophila_2:1636800_at:332:71; Interrogation_Position=2051; Antisense; AGGCGCAGCCACTCAAGGGATCAGG
>probe:Drosophila_2:1636800_at:97:475; Interrogation_Position=2118; Antisense; GTTAGACGCTGGTGTTGAACTTTAA
>probe:Drosophila_2:1636800_at:4:153; Interrogation_Position=2161; Antisense; ACAGGGCATCTAGAATTCGGTCACG
>probe:Drosophila_2:1636800_at:425:717; Interrogation_Position=2176; Antisense; TTCGGTCACGCCAAAGGCAGGGCAT
>probe:Drosophila_2:1636800_at:422:569; Interrogation_Position=2191; Antisense; GGCAGGGCATTTACCTTTAAAACAT

Paste this into a BLAST search page for me
GAATGCACACCCTCATAGTCGCGTGAAGCTGGCCATCACGGCGTCGTATGTGGAACCGTTTACATATTCTCCGCCGAGCAGTTCCCAACCGTGGTTAGAAATCAGTGGCATGATGGCACCGTTCCATCTGCGGATCCCTGACCTTGGTAGGAGACGCACAATAAGCCCATGCTGGATGGCGAGCGCTTTGGCAAGAAGACAGATGTCTACCTGGAAACGGGCCAAAGGCGCAGCCACTCAAGGGATCAGGGTTAGACGCTGGTGTTGAACTTTAAACAGGGCATCTAGAATTCGGTCACGTTCGGTCACGCCAAAGGCAGGGCATGGCAGGGCATTTACCTTTAAAACAT

Full Affymetrix probeset data:

Annotations for 1636800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720