FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636801_at:

>probe:Drosophila_2:1636801_at:162:325; Interrogation_Position=3464; Antisense; GCGACTTGGACGCTAACTTCAGCAA
>probe:Drosophila_2:1636801_at:584:325; Interrogation_Position=3492; Antisense; GCGACTGACTGCCTTGAAGTACTCA
>probe:Drosophila_2:1636801_at:674:179; Interrogation_Position=3594; Antisense; AAACATCTATGTACCGTCGGAGCAG
>probe:Drosophila_2:1636801_at:225:97; Interrogation_Position=3624; Antisense; AGATACGGTGCACCTGTTTCACATG
>probe:Drosophila_2:1636801_at:93:153; Interrogation_Position=3651; Antisense; ACATCATCGCATGGTTTCCCTAAGA
>probe:Drosophila_2:1636801_at:216:479; Interrogation_Position=3664; Antisense; GTTTCCCTAAGATTTCTAGCCTGGC
>probe:Drosophila_2:1636801_at:35:675; Interrogation_Position=3680; Antisense; TAGCCTGGCATTTCTTGGGTACTAA
>probe:Drosophila_2:1636801_at:73:425; Interrogation_Position=3715; Antisense; GAGACGCACGACTCCATCGAAGATG
>probe:Drosophila_2:1636801_at:95:375; Interrogation_Position=3792; Antisense; GAAGTTTGCCAACGCTCTCAAGAAT
>probe:Drosophila_2:1636801_at:680:469; Interrogation_Position=3850; Antisense; GTTCCAGAGGACTGATTCGTCGCCA
>probe:Drosophila_2:1636801_at:442:489; Interrogation_Position=3920; Antisense; GTACAAACGCTACACCGATCTGAAA
>probe:Drosophila_2:1636801_at:319:303; Interrogation_Position=3950; Antisense; CCGGCTTCTCCCAATTTTATTATGT
>probe:Drosophila_2:1636801_at:125:469; Interrogation_Position=3983; Antisense; GTTGCTATTTGCTACGAAGCTCCTG
>probe:Drosophila_2:1636801_at:178:379; Interrogation_Position=3998; Antisense; GAAGCTCCTGGTATTTCATGTTGTA

Paste this into a BLAST search page for me
GCGACTTGGACGCTAACTTCAGCAAGCGACTGACTGCCTTGAAGTACTCAAAACATCTATGTACCGTCGGAGCAGAGATACGGTGCACCTGTTTCACATGACATCATCGCATGGTTTCCCTAAGAGTTTCCCTAAGATTTCTAGCCTGGCTAGCCTGGCATTTCTTGGGTACTAAGAGACGCACGACTCCATCGAAGATGGAAGTTTGCCAACGCTCTCAAGAATGTTCCAGAGGACTGATTCGTCGCCAGTACAAACGCTACACCGATCTGAAACCGGCTTCTCCCAATTTTATTATGTGTTGCTATTTGCTACGAAGCTCCTGGAAGCTCCTGGTATTTCATGTTGTA

Full Affymetrix probeset data:

Annotations for 1636801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720