Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636804_at:

>probe:Drosophila_2:1636804_at:258:197; Interrogation_Position=1053; Antisense; AACGGAGTCTGTGCACCGGACGGAC
>probe:Drosophila_2:1636804_at:123:335; Interrogation_Position=519; Antisense; GCTGCTGGAGTTCATATGCTACAAG
>probe:Drosophila_2:1636804_at:509:197; Interrogation_Position=544; Antisense; AACGGAGACCAGATTGCGCTCTTTA
>probe:Drosophila_2:1636804_at:712:641; Interrogation_Position=563; Antisense; TCTTTATCGCCGAAGAGGGCCCGGA
>probe:Drosophila_2:1636804_at:565:371; Interrogation_Position=607; Antisense; GAAGGCATCGCCAATTGCCTGAACT
>probe:Drosophila_2:1636804_at:478:543; Interrogation_Position=643; Antisense; GGATATCTGCCCAAGTCGATTAGCC
>probe:Drosophila_2:1636804_at:276:457; Interrogation_Position=660; Antisense; GATTAGCCCGGAGTGGGATCTGCCC
>probe:Drosophila_2:1636804_at:674:645; Interrogation_Position=692; Antisense; TCTTGGGTCCGAAGCAGTGCGTCGA
>probe:Drosophila_2:1636804_at:267:413; Interrogation_Position=715; Antisense; GACCTCTACGCATTCGAGACGTGCA
>probe:Drosophila_2:1636804_at:402:509; Interrogation_Position=735; Antisense; GTGCACCGTCAGTCTGCTGGAGAAG
>probe:Drosophila_2:1636804_at:630:109; Interrogation_Position=755; Antisense; AGAAGTGCGATACGATCACTCCCAG
>probe:Drosophila_2:1636804_at:240:519; Interrogation_Position=787; Antisense; GTGGAGTCCATGTTTCGATACGTGA
>probe:Drosophila_2:1636804_at:201:43; Interrogation_Position=838; Antisense; ATCGACAGGGTCAAGCTGCAGCACC
>probe:Drosophila_2:1636804_at:23:587; Interrogation_Position=925; Antisense; TGGACCTCTGCGAGCCTGCTAATGG

Paste this into a BLAST search page for me
AACGGAGTCTGTGCACCGGACGGACGCTGCTGGAGTTCATATGCTACAAGAACGGAGACCAGATTGCGCTCTTTATCTTTATCGCCGAAGAGGGCCCGGAGAAGGCATCGCCAATTGCCTGAACTGGATATCTGCCCAAGTCGATTAGCCGATTAGCCCGGAGTGGGATCTGCCCTCTTGGGTCCGAAGCAGTGCGTCGAGACCTCTACGCATTCGAGACGTGCAGTGCACCGTCAGTCTGCTGGAGAAGAGAAGTGCGATACGATCACTCCCAGGTGGAGTCCATGTTTCGATACGTGAATCGACAGGGTCAAGCTGCAGCACCTGGACCTCTGCGAGCCTGCTAATGG

Full Affymetrix probeset data:

Annotations for 1636804_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime