FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636806_at:

>probe:Drosophila_2:1636806_at:157:345; Interrogation_Position=1023; Antisense; GCATTGCTGCTCATACTGGTGGTGG
>probe:Drosophila_2:1636806_at:558:21; Interrogation_Position=1108; Antisense; ATATATGGAGCCGACTTTATGGACG
>probe:Drosophila_2:1636806_at:120:65; Interrogation_Position=1126; Antisense; ATGGACGGTTCTGGTGGTTCCGCTA
>probe:Drosophila_2:1636806_at:229:343; Interrogation_Position=1164; Antisense; GCTTATCTGCTCTCGATTTGCGTAC
>probe:Drosophila_2:1636806_at:612:19; Interrogation_Position=1179; Antisense; ATTTGCGTACTCTTTTGCGGACTAC
>probe:Drosophila_2:1636806_at:261:555; Interrogation_Position=1197; Antisense; GGACTACGTCACATGCCGGAAAGCT
>probe:Drosophila_2:1636806_at:429:149; Interrogation_Position=1238; Antisense; ACTTAGTCTATTCCTGGTGCTGTGC
>probe:Drosophila_2:1636806_at:673:623; Interrogation_Position=1297; Antisense; TGCCGTACATTCTGTTTCGACTCAA
>probe:Drosophila_2:1636806_at:477:129; Interrogation_Position=1323; Antisense; ACACGGCACACTCGCAAGGGTTACG
>probe:Drosophila_2:1636806_at:601:621; Interrogation_Position=1375; Antisense; TGCTGCTCAATGTGGCCACGTTTTA
>probe:Drosophila_2:1636806_at:199:181; Interrogation_Position=1429; Antisense; AAAACTACCGCACTCCTCAAAGGAT
>probe:Drosophila_2:1636806_at:521:529; Interrogation_Position=948; Antisense; GGGATATCCAACACCATACGTCAGT
>probe:Drosophila_2:1636806_at:367:27; Interrogation_Position=963; Antisense; ATACGTCAGTTTCGTCCGGCAGCAG
>probe:Drosophila_2:1636806_at:413:73; Interrogation_Position=999; Antisense; AGGAATCGCGTGCTGTCCCTATTGG

Paste this into a BLAST search page for me
GCATTGCTGCTCATACTGGTGGTGGATATATGGAGCCGACTTTATGGACGATGGACGGTTCTGGTGGTTCCGCTAGCTTATCTGCTCTCGATTTGCGTACATTTGCGTACTCTTTTGCGGACTACGGACTACGTCACATGCCGGAAAGCTACTTAGTCTATTCCTGGTGCTGTGCTGCCGTACATTCTGTTTCGACTCAAACACGGCACACTCGCAAGGGTTACGTGCTGCTCAATGTGGCCACGTTTTAAAAACTACCGCACTCCTCAAAGGATGGGATATCCAACACCATACGTCAGTATACGTCAGTTTCGTCCGGCAGCAGAGGAATCGCGTGCTGTCCCTATTGG

Full Affymetrix probeset data:

Annotations for 1636806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720