FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636807_at:

>probe:Drosophila_2:1636807_at:191:217; Interrogation_Position=1048; Antisense; AAGTATGCCGGTTGGGCTCAAGCTA
>probe:Drosophila_2:1636807_at:13:209; Interrogation_Position=1067; Antisense; AAGCTATTCTCTTTTCTGCCGATTT
>probe:Drosophila_2:1636807_at:489:163; Interrogation_Position=1104; Antisense; AAATACTTCCACAGTTGCTTGTAAG
>probe:Drosophila_2:1636807_at:710:623; Interrogation_Position=697; Antisense; TGCGAGGATCTTAATGCCCAGCTAA
>probe:Drosophila_2:1636807_at:516:655; Interrogation_Position=719; Antisense; TAAGGGCTGCCAAGTTCGGTTATCG
>probe:Drosophila_2:1636807_at:313:541; Interrogation_Position=736; Antisense; GGTTATCGGGCCAAGTTCATAGCAC
>probe:Drosophila_2:1636807_at:215:659; Interrogation_Position=806; Antisense; TAAGCCTAAAGAGCATGCCGTTCGA
>probe:Drosophila_2:1636807_at:60:51; Interrogation_Position=820; Antisense; ATGCCGTTCGAAAAAGCTCGCGAGG
>probe:Drosophila_2:1636807_at:450:437; Interrogation_Position=841; Antisense; GAGGAGCTGACACTGCTACCCGGAA
>probe:Drosophila_2:1636807_at:234:171; Interrogation_Position=874; Antisense; AAAGTGGCCGATTGCATCTGCCTTA
>probe:Drosophila_2:1636807_at:600:39; Interrogation_Position=889; Antisense; ATCTGCCTTATGTCAATGGGTCACT
>probe:Drosophila_2:1636807_at:367:63; Interrogation_Position=904; Antisense; ATGGGTCACTTGGAGTCAGTGCCCG
>probe:Drosophila_2:1636807_at:534:505; Interrogation_Position=922; Antisense; GTGCCCGTCGACATTCATATTTACA
>probe:Drosophila_2:1636807_at:382:255; Interrogation_Position=955; Antisense; CAAAATTACTACCTGCCACATCTAA

Paste this into a BLAST search page for me
AAGTATGCCGGTTGGGCTCAAGCTAAAGCTATTCTCTTTTCTGCCGATTTAAATACTTCCACAGTTGCTTGTAAGTGCGAGGATCTTAATGCCCAGCTAATAAGGGCTGCCAAGTTCGGTTATCGGGTTATCGGGCCAAGTTCATAGCACTAAGCCTAAAGAGCATGCCGTTCGAATGCCGTTCGAAAAAGCTCGCGAGGGAGGAGCTGACACTGCTACCCGGAAAAAGTGGCCGATTGCATCTGCCTTAATCTGCCTTATGTCAATGGGTCACTATGGGTCACTTGGAGTCAGTGCCCGGTGCCCGTCGACATTCATATTTACACAAAATTACTACCTGCCACATCTAA

Full Affymetrix probeset data:

Annotations for 1636807_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720