Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636809_at:

>probe:Drosophila_2:1636809_at:318:389; Interrogation_Position=2601; Antisense; GAAAACAAACGCTCCTGACAACAGA
>probe:Drosophila_2:1636809_at:542:21; Interrogation_Position=2707; Antisense; ATATAGACTCATGCCTACGGAAGTG
>probe:Drosophila_2:1636809_at:335:669; Interrogation_Position=2722; Antisense; TACGGAAGTGACAACCAGCCAGCAA
>probe:Drosophila_2:1636809_at:11:243; Interrogation_Position=2745; Antisense; AATATATATTTTTAGCCATGGCCAT
>probe:Drosophila_2:1636809_at:54:313; Interrogation_Position=2759; Antisense; GCCATGGCCATAGGGTTTACGATCC
>probe:Drosophila_2:1636809_at:115:709; Interrogation_Position=2775; Antisense; TTACGATCCACCAAAACGGCTTTCT
>probe:Drosophila_2:1636809_at:305:695; Interrogation_Position=2805; Antisense; TTTAGACCGGTTCTTGAGCTTCCTG
>probe:Drosophila_2:1636809_at:673:417; Interrogation_Position=2820; Antisense; GAGCTTCCTGCAGACATTTTACCGG
>probe:Drosophila_2:1636809_at:290:401; Interrogation_Position=2832; Antisense; GACATTTTACCGGACGAGCAACAAT
>probe:Drosophila_2:1636809_at:354:373; Interrogation_Position=2948; Antisense; GAAGTACACGTAGCGGCTCAGCGAT
>probe:Drosophila_2:1636809_at:398:339; Interrogation_Position=2963; Antisense; GCTCAGCGATCCGTCGCATTTTTTA
>probe:Drosophila_2:1636809_at:140:629; Interrogation_Position=2972; Antisense; TCCGTCGCATTTTTTATGGGTGGGC
>probe:Drosophila_2:1636809_at:664:699; Interrogation_Position=3006; Antisense; TTTTACGCCGGCCAAACAAATGCAA
>probe:Drosophila_2:1636809_at:624:615; Interrogation_Position=3026; Antisense; TGCAACGCCCACACAGACTATTATA

Paste this into a BLAST search page for me
GAAAACAAACGCTCCTGACAACAGAATATAGACTCATGCCTACGGAAGTGTACGGAAGTGACAACCAGCCAGCAAAATATATATTTTTAGCCATGGCCATGCCATGGCCATAGGGTTTACGATCCTTACGATCCACCAAAACGGCTTTCTTTTAGACCGGTTCTTGAGCTTCCTGGAGCTTCCTGCAGACATTTTACCGGGACATTTTACCGGACGAGCAACAATGAAGTACACGTAGCGGCTCAGCGATGCTCAGCGATCCGTCGCATTTTTTATCCGTCGCATTTTTTATGGGTGGGCTTTTACGCCGGCCAAACAAATGCAATGCAACGCCCACACAGACTATTATA

Full Affymetrix probeset data:

Annotations for 1636809_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime