Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636811_at:

>probe:Drosophila_2:1636811_at:394:647; Interrogation_Position=2414; Antisense; TCAGTTGTACGACCAGACCCGTTTC
>probe:Drosophila_2:1636811_at:599:473; Interrogation_Position=2440; Antisense; GTTACTCCCTCAACTTTTTATCCTG
>probe:Drosophila_2:1636811_at:351:705; Interrogation_Position=2476; Antisense; TTATGGGACTCCTCTTCGATTACCT
>probe:Drosophila_2:1636811_at:398:673; Interrogation_Position=2496; Antisense; TACCTCGTTTGGTACTACGGACGCA
>probe:Drosophila_2:1636811_at:117:671; Interrogation_Position=2511; Antisense; TACGGACGCAACCTGGACATTTATG
>probe:Drosophila_2:1636811_at:308:627; Interrogation_Position=2564; Antisense; TGCCAACAGAAAAGACCAGCCCATT
>probe:Drosophila_2:1636811_at:467:13; Interrogation_Position=2586; Antisense; ATTACTCCGCTCCTGGCCAAGAAAT
>probe:Drosophila_2:1636811_at:108:211; Interrogation_Position=2638; Antisense; AAGAAAGTGCAACCCATCCGTGATA
>probe:Drosophila_2:1636811_at:518:187; Interrogation_Position=2691; Antisense; AACACGCCAGTTCCGAGTATTTCAT
>probe:Drosophila_2:1636811_at:473:711; Interrogation_Position=2724; Antisense; TTCAAAGCACATTCCTAGAGTTAGT
>probe:Drosophila_2:1636811_at:572:3; Interrogation_Position=2772; Antisense; ATTGGGCAAAGCCTGTACTCCAACG
>probe:Drosophila_2:1636811_at:449:299; Interrogation_Position=2795; Antisense; CGCCATATGTACAAATCTTCCGCTT
>probe:Drosophila_2:1636811_at:526:675; Interrogation_Position=2833; Antisense; TAGCTATTGAACTCGCGCTGTCAAA
>probe:Drosophila_2:1636811_at:21:335; Interrogation_Position=2849; Antisense; GCTGTCAAATGTCTTCTTTCAGTGT

Paste this into a BLAST search page for me
TCAGTTGTACGACCAGACCCGTTTCGTTACTCCCTCAACTTTTTATCCTGTTATGGGACTCCTCTTCGATTACCTTACCTCGTTTGGTACTACGGACGCATACGGACGCAACCTGGACATTTATGTGCCAACAGAAAAGACCAGCCCATTATTACTCCGCTCCTGGCCAAGAAATAAGAAAGTGCAACCCATCCGTGATAAACACGCCAGTTCCGAGTATTTCATTTCAAAGCACATTCCTAGAGTTAGTATTGGGCAAAGCCTGTACTCCAACGCGCCATATGTACAAATCTTCCGCTTTAGCTATTGAACTCGCGCTGTCAAAGCTGTCAAATGTCTTCTTTCAGTGT

Full Affymetrix probeset data:

Annotations for 1636811_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime