Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636812_at:

>probe:Drosophila_2:1636812_at:496:385; Interrogation_Position=1057; Antisense; GAACAACACGGATGGCTCGGGCAGC
>probe:Drosophila_2:1636812_at:409:547; Interrogation_Position=1084; Antisense; GGATGAGAATATTTTGCGCCCCAAA
>probe:Drosophila_2:1636812_at:640:693; Interrogation_Position=1096; Antisense; TTTGCGCCCCAAACCCGAAAATGAT
>probe:Drosophila_2:1636812_at:697:129; Interrogation_Position=1136; Antisense; ACCTCCATTAATCCTGTAAATCTCC
>probe:Drosophila_2:1636812_at:587:229; Interrogation_Position=1154; Antisense; AATCTCCAGAATGCCAACAAACCGA
>probe:Drosophila_2:1636812_at:97:673; Interrogation_Position=1221; Antisense; TACCAAGTGCTCCTCCGGCATTGGA
>probe:Drosophila_2:1636812_at:199:199; Interrogation_Position=1262; Antisense; AACGTTCCCAACGATCTGCCAGATA
>probe:Drosophila_2:1636812_at:584:451; Interrogation_Position=1274; Antisense; GATCTGCCAGATATTCCGGGCGCAG
>probe:Drosophila_2:1636812_at:345:465; Interrogation_Position=1327; Antisense; GATTGATTTCGATGACCTGTCACGT
>probe:Drosophila_2:1636812_at:674:489; Interrogation_Position=1345; Antisense; GTCACGTCGCTTCGAGAACCTTAAG
>probe:Drosophila_2:1636812_at:164:351; Interrogation_Position=1391; Antisense; GCAGATCACCTTTTAAGTCTACAGT
>probe:Drosophila_2:1636812_at:10:725; Interrogation_Position=1420; Antisense; TTGTTATAATCTCTGTCCTGTTCTA
>probe:Drosophila_2:1636812_at:60:99; Interrogation_Position=1542; Antisense; AGATGGTTGACCTATTGCTTTTCAT
>probe:Drosophila_2:1636812_at:626:619; Interrogation_Position=1557; Antisense; TGCTTTTCATATTCGCAATCTTGAT

Paste this into a BLAST search page for me
GAACAACACGGATGGCTCGGGCAGCGGATGAGAATATTTTGCGCCCCAAATTTGCGCCCCAAACCCGAAAATGATACCTCCATTAATCCTGTAAATCTCCAATCTCCAGAATGCCAACAAACCGATACCAAGTGCTCCTCCGGCATTGGAAACGTTCCCAACGATCTGCCAGATAGATCTGCCAGATATTCCGGGCGCAGGATTGATTTCGATGACCTGTCACGTGTCACGTCGCTTCGAGAACCTTAAGGCAGATCACCTTTTAAGTCTACAGTTTGTTATAATCTCTGTCCTGTTCTAAGATGGTTGACCTATTGCTTTTCATTGCTTTTCATATTCGCAATCTTGAT

Full Affymetrix probeset data:

Annotations for 1636812_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime