FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636818_at:

>probe:Drosophila_2:1636818_at:481:287; Interrogation_Position=145; Antisense; CTGGACGTATGTGCGCGGGACTTTC
>probe:Drosophila_2:1636818_at:719:527; Interrogation_Position=161; Antisense; GGGACTTTCACTTGCGGATGGACGA
>probe:Drosophila_2:1636818_at:96:409; Interrogation_Position=181; Antisense; GACGACAGTGCCTGGTGCCATGGAT
>probe:Drosophila_2:1636818_at:122:307; Interrogation_Position=198; Antisense; CCATGGATCCTGTCTGGTTGGGCGA
>probe:Drosophila_2:1636818_at:262:623; Interrogation_Position=281; Antisense; TGCTGGACGTGCACCACTTTCAGAT
>probe:Drosophila_2:1636818_at:577:97; Interrogation_Position=302; Antisense; AGATCTCTGAGCTCACGGTGAAGGC
>probe:Drosophila_2:1636818_at:693:181; Interrogation_Position=329; Antisense; AAAACAGCGACACCGTGTGCGTGGA
>probe:Drosophila_2:1636818_at:337:223; Interrogation_Position=382; Antisense; AAGGGTCAGTTGTGCATCACTCGCG
>probe:Drosophila_2:1636818_at:215:429; Interrogation_Position=406; Antisense; GAGTTTACGCGATCCTACAAGCTAC
>probe:Drosophila_2:1636818_at:356:665; Interrogation_Position=421; Antisense; TACAAGCTACCACGGCACTACGATG
>probe:Drosophila_2:1636818_at:457:129; Interrogation_Position=463; Antisense; ACCTTCTCTGCGGACGGAATACTGA
>probe:Drosophila_2:1636818_at:72:113; Interrogation_Position=501; Antisense; AGCACCACCGAAACTGGACGACGTG
>probe:Drosophila_2:1636818_at:383:451; Interrogation_Position=534; Antisense; GATCGAGATTGAGCCCACGGGCAAT
>probe:Drosophila_2:1636818_at:56:245; Interrogation_Position=556; Antisense; AATTACTTTGGCAGCGTGTCCGATC

Paste this into a BLAST search page for me
CTGGACGTATGTGCGCGGGACTTTCGGGACTTTCACTTGCGGATGGACGAGACGACAGTGCCTGGTGCCATGGATCCATGGATCCTGTCTGGTTGGGCGATGCTGGACGTGCACCACTTTCAGATAGATCTCTGAGCTCACGGTGAAGGCAAAACAGCGACACCGTGTGCGTGGAAAGGGTCAGTTGTGCATCACTCGCGGAGTTTACGCGATCCTACAAGCTACTACAAGCTACCACGGCACTACGATGACCTTCTCTGCGGACGGAATACTGAAGCACCACCGAAACTGGACGACGTGGATCGAGATTGAGCCCACGGGCAATAATTACTTTGGCAGCGTGTCCGATC

Full Affymetrix probeset data:

Annotations for 1636818_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720