Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636821_at:

>probe:Drosophila_2:1636821_at:474:65; Interrogation_Position=13; Antisense; ATGGTCATATTGAATCCTTATGCTA
>probe:Drosophila_2:1636821_at:7:691; Interrogation_Position=20; Antisense; TATTGAATCCTTATGCTACTTGCTA
>probe:Drosophila_2:1636821_at:2:725; Interrogation_Position=22; Antisense; TTGAATCCTTATGCTACTTGCTACT
>probe:Drosophila_2:1636821_at:82:369; Interrogation_Position=24; Antisense; GAATCCTTATGCTACTTGCTACTTG
>probe:Drosophila_2:1636821_at:34:49; Interrogation_Position=26; Antisense; ATCCTTATGCTACTTGCTACTTGAA
>probe:Drosophila_2:1636821_at:315:241; Interrogation_Position=29; Antisense; CTTATGCTACTTGCTACTTGAATTC
>probe:Drosophila_2:1636821_at:498:51; Interrogation_Position=32; Antisense; ATGCTACTTGCTACTTGAATTCACA
>probe:Drosophila_2:1636821_at:12:341; Interrogation_Position=34; Antisense; GCTACTTGCTACTTGAATTCACAAA
>probe:Drosophila_2:1636821_at:390:149; Interrogation_Position=37; Antisense; ACTTGCTACTTGAATTCACAAACTA
>probe:Drosophila_2:1636821_at:517:339; Interrogation_Position=41; Antisense; GCTACTTGAATTCACAAACTATGTT
>probe:Drosophila_2:1636821_at:723:361; Interrogation_Position=48; Antisense; GAATTCACAAACTATGTTTTACCAT
>probe:Drosophila_2:1636821_at:277:157; Interrogation_Position=54; Antisense; ACAAACTATGTTTTACCATTTTCAG
>probe:Drosophila_2:1636821_at:232:697; Interrogation_Position=65; Antisense; TTTACCATTTTCAGTCCGACGTGGA
>probe:Drosophila_2:1636821_at:435:665; Interrogation_Position=67; Antisense; TACCATTTTCAGTCCGACGTGGATC

Paste this into a BLAST search page for me
ATGGTCATATTGAATCCTTATGCTATATTGAATCCTTATGCTACTTGCTATTGAATCCTTATGCTACTTGCTACTGAATCCTTATGCTACTTGCTACTTGATCCTTATGCTACTTGCTACTTGAACTTATGCTACTTGCTACTTGAATTCATGCTACTTGCTACTTGAATTCACAGCTACTTGCTACTTGAATTCACAAAACTTGCTACTTGAATTCACAAACTAGCTACTTGAATTCACAAACTATGTTGAATTCACAAACTATGTTTTACCATACAAACTATGTTTTACCATTTTCAGTTTACCATTTTCAGTCCGACGTGGATACCATTTTCAGTCCGACGTGGATC

Full Affymetrix probeset data:

Annotations for 1636821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime