FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636823_at:

>probe:Drosophila_2:1636823_at:229:43; Interrogation_Position=215; Antisense; ATCGATTTTATAACGCTGCCAACCA
>probe:Drosophila_2:1636823_at:613:139; Interrogation_Position=239; Antisense; ACGTCAACGACATAGCGCTGCTGAA
>probe:Drosophila_2:1636823_at:655:59; Interrogation_Position=287; Antisense; ATGTTCATATCCAGCCCATTTGCAT
>probe:Drosophila_2:1636823_at:23:19; Interrogation_Position=304; Antisense; ATTTGCATACTCCTAAATCCCGCTA
>probe:Drosophila_2:1636823_at:345:517; Interrogation_Position=338; Antisense; GTGTGGCTACATATCAGACCTTCGG
>probe:Drosophila_2:1636823_at:142:19; Interrogation_Position=395; Antisense; ATTTGCTGCAGACCGCGGAACTTAG
>probe:Drosophila_2:1636823_at:262:381; Interrogation_Position=412; Antisense; GAACTTAGGGCATACGACGCCGCAT
>probe:Drosophila_2:1636823_at:594:353; Interrogation_Position=440; Antisense; GCAGCCGGAGTTTTCATGCGTATAT
>probe:Drosophila_2:1636823_at:24:561; Interrogation_Position=469; Antisense; GGAAACCAGATTTGCGCCGGCCATG
>probe:Drosophila_2:1636823_at:513:429; Interrogation_Position=557; Antisense; GAGTTAAACGCTACCTGCAGCTGGG
>probe:Drosophila_2:1636823_at:181:287; Interrogation_Position=577; Antisense; CTGGGCATCGTGAGCTATGGTCCAA
>probe:Drosophila_2:1636823_at:329:591; Interrogation_Position=594; Antisense; TGGTCCAACGGATTGTCAAAGCCCC
>probe:Drosophila_2:1636823_at:542:173; Interrogation_Position=611; Antisense; AAAGCCCCGGAGTTTATACATATGT
>probe:Drosophila_2:1636823_at:269:635; Interrogation_Position=742; Antisense; TCGACAAACTCCTTATCGGTGATTT

Paste this into a BLAST search page for me
ATCGATTTTATAACGCTGCCAACCAACGTCAACGACATAGCGCTGCTGAAATGTTCATATCCAGCCCATTTGCATATTTGCATACTCCTAAATCCCGCTAGTGTGGCTACATATCAGACCTTCGGATTTGCTGCAGACCGCGGAACTTAGGAACTTAGGGCATACGACGCCGCATGCAGCCGGAGTTTTCATGCGTATATGGAAACCAGATTTGCGCCGGCCATGGAGTTAAACGCTACCTGCAGCTGGGCTGGGCATCGTGAGCTATGGTCCAATGGTCCAACGGATTGTCAAAGCCCCAAAGCCCCGGAGTTTATACATATGTTCGACAAACTCCTTATCGGTGATTT

Full Affymetrix probeset data:

Annotations for 1636823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720