FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636825_at:

>probe:Drosophila_2:1636825_at:604:135; Interrogation_Position=1050; Antisense; ACGACTGGCCATGGATCCGCAGAGA
>probe:Drosophila_2:1636825_at:584:449; Interrogation_Position=1063; Antisense; GATCCGCAGAGAAGCACCGAGCTGA
>probe:Drosophila_2:1636825_at:126:419; Interrogation_Position=1081; Antisense; GAGCTGACCAACATCGAGCACGACT
>probe:Drosophila_2:1636825_at:207:137; Interrogation_Position=1100; Antisense; ACGACTTCGAGGTGCTGAACCACGG
>probe:Drosophila_2:1636825_at:292:291; Interrogation_Position=1185; Antisense; CGTCAACTTCACCATCAGCTTTAAG
>probe:Drosophila_2:1636825_at:370:137; Interrogation_Position=1226; Antisense; ACGGCAGGAGAATCGCCTTCGGGAA
>probe:Drosophila_2:1636825_at:115:373; Interrogation_Position=1248; Antisense; GAAGGTTCGCAAGGGCATGCAGCTC
>probe:Drosophila_2:1636825_at:373:57; Interrogation_Position=1309; Antisense; ATGAGCCACAACTTGATCTCGCTGA
>probe:Drosophila_2:1636825_at:135:39; Interrogation_Position=1324; Antisense; ATCTCGCTGACGGACTGTGGAGTGA
>probe:Drosophila_2:1636825_at:722:529; Interrogation_Position=1381; Antisense; GGGATCTACTCATAACTTTTCGAAG
>probe:Drosophila_2:1636825_at:558:703; Interrogation_Position=1447; Antisense; TTATTCTTAAGCCATGTCACCCCAC
>probe:Drosophila_2:1636825_at:492:495; Interrogation_Position=1462; Antisense; GTCACCCCACTTAAAGCTGCTGTAA
>probe:Drosophila_2:1636825_at:108:429; Interrogation_Position=970; Antisense; GAGTTCATGAGGATCTGCACCCAGA
>probe:Drosophila_2:1636825_at:230:189; Interrogation_Position=997; Antisense; AACAGTAGCGCCATCGTATTCAACC

Paste this into a BLAST search page for me
ACGACTGGCCATGGATCCGCAGAGAGATCCGCAGAGAAGCACCGAGCTGAGAGCTGACCAACATCGAGCACGACTACGACTTCGAGGTGCTGAACCACGGCGTCAACTTCACCATCAGCTTTAAGACGGCAGGAGAATCGCCTTCGGGAAGAAGGTTCGCAAGGGCATGCAGCTCATGAGCCACAACTTGATCTCGCTGAATCTCGCTGACGGACTGTGGAGTGAGGGATCTACTCATAACTTTTCGAAGTTATTCTTAAGCCATGTCACCCCACGTCACCCCACTTAAAGCTGCTGTAAGAGTTCATGAGGATCTGCACCCAGAAACAGTAGCGCCATCGTATTCAACC

Full Affymetrix probeset data:

Annotations for 1636825_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720