FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636826_at:

>probe:Drosophila_2:1636826_at:648:619; Interrogation_Position=110; Antisense; TGCTCACCCTTAAGTCAGCCGAGGA
>probe:Drosophila_2:1636826_at:265:563; Interrogation_Position=132; Antisense; GGAACGCAATGATGACGGCCAAAAC
>probe:Drosophila_2:1636826_at:51:579; Interrogation_Position=148; Antisense; GGCCAAAACCGTCATGACAAGCTCT
>probe:Drosophila_2:1636826_at:78:397; Interrogation_Position=163; Antisense; GACAAGCTCTTACAATTCAAACGGG
>probe:Drosophila_2:1636826_at:231:527; Interrogation_Position=185; Antisense; GGGAAGCCGATTTGCTGGCAACCAA
>probe:Drosophila_2:1636826_at:256:359; Interrogation_Position=202; Antisense; GCAACCAAATTTGATTCGCCCGATT
>probe:Drosophila_2:1636826_at:51:631; Interrogation_Position=217; Antisense; TCGCCCGATTATTACACCCAAAAGG
>probe:Drosophila_2:1636826_at:637:161; Interrogation_Position=24; Antisense; ACAATATGCGGTCGAGTTTGCCCAC
>probe:Drosophila_2:1636826_at:641:259; Interrogation_Position=286; Antisense; CACGAGAAGTGGCTCCTGGATGAAA
>probe:Drosophila_2:1636826_at:441:697; Interrogation_Position=343; Antisense; TTTCTGCAGGATGCGTTTGTTGGCA
>probe:Drosophila_2:1636826_at:706:429; Interrogation_Position=37; Antisense; GAGTTTGCCCACGATGATAACCTAC
>probe:Drosophila_2:1636826_at:497:7; Interrogation_Position=53; Antisense; ATAACCTACTGGGTGGTAGCCCATC
>probe:Drosophila_2:1636826_at:430:537; Interrogation_Position=67; Antisense; GGTAGCCCATCGAATGTGTCTCAAC
>probe:Drosophila_2:1636826_at:279:515; Interrogation_Position=82; Antisense; GTGTCTCAACTCTCGGAATTTCTGG

Paste this into a BLAST search page for me
TGCTCACCCTTAAGTCAGCCGAGGAGGAACGCAATGATGACGGCCAAAACGGCCAAAACCGTCATGACAAGCTCTGACAAGCTCTTACAATTCAAACGGGGGGAAGCCGATTTGCTGGCAACCAAGCAACCAAATTTGATTCGCCCGATTTCGCCCGATTATTACACCCAAAAGGACAATATGCGGTCGAGTTTGCCCACCACGAGAAGTGGCTCCTGGATGAAATTTCTGCAGGATGCGTTTGTTGGCAGAGTTTGCCCACGATGATAACCTACATAACCTACTGGGTGGTAGCCCATCGGTAGCCCATCGAATGTGTCTCAACGTGTCTCAACTCTCGGAATTTCTGG

Full Affymetrix probeset data:

Annotations for 1636826_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720