FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636828_at:

>probe:Drosophila_2:1636828_at:297:521; Interrogation_Position=1480; Antisense; GTGGCGAATGGCTACCATGACTTCT
>probe:Drosophila_2:1636828_at:283:269; Interrogation_Position=1495; Antisense; CATGACTTCTATCCCTTGGAACTCA
>probe:Drosophila_2:1636828_at:426:105; Interrogation_Position=1536; Antisense; AGACTTTTCGGCACGATTCGAGCGA
>probe:Drosophila_2:1636828_at:706:91; Interrogation_Position=1560; Antisense; AGTTCAGAGGGCAGCTCCGGACGAA
>probe:Drosophila_2:1636828_at:469:71; Interrogation_Position=1585; Antisense; AGGCTAACCACAATTGCGCTGATCA
>probe:Drosophila_2:1636828_at:206:623; Interrogation_Position=1599; Antisense; TGCGCTGATCAGTAACTTGGCCTAC
>probe:Drosophila_2:1636828_at:265:203; Interrogation_Position=1633; Antisense; AAGCACCCGAATATCAGCCGTTTGA
>probe:Drosophila_2:1636828_at:569:479; Interrogation_Position=1652; Antisense; GTTTGACCTTTGTTCGCCAACCGAT
>probe:Drosophila_2:1636828_at:245:453; Interrogation_Position=1674; Antisense; GATCTACATGTATCACCTCGTCATC
>probe:Drosophila_2:1636828_at:194:307; Interrogation_Position=1689; Antisense; CCTCGTCATCTACTTTCCTAGAAGA
>probe:Drosophila_2:1636828_at:488:597; Interrogation_Position=1704; Antisense; TCCTAGAAGATTCTTTCTCCGGCCA
>probe:Drosophila_2:1636828_at:444:81; Interrogation_Position=1817; Antisense; AGGTGGCTTCTAACGATCCAGTTCT
>probe:Drosophila_2:1636828_at:468:141; Interrogation_Position=1889; Antisense; ACGGACTGGTGATTGTCCTGGCCAC
>probe:Drosophila_2:1636828_at:515:59; Interrogation_Position=1918; Antisense; ATGTTCATCCTGGAATTGCTGGCGG

Paste this into a BLAST search page for me
GTGGCGAATGGCTACCATGACTTCTCATGACTTCTATCCCTTGGAACTCAAGACTTTTCGGCACGATTCGAGCGAAGTTCAGAGGGCAGCTCCGGACGAAAGGCTAACCACAATTGCGCTGATCATGCGCTGATCAGTAACTTGGCCTACAAGCACCCGAATATCAGCCGTTTGAGTTTGACCTTTGTTCGCCAACCGATGATCTACATGTATCACCTCGTCATCCCTCGTCATCTACTTTCCTAGAAGATCCTAGAAGATTCTTTCTCCGGCCAAGGTGGCTTCTAACGATCCAGTTCTACGGACTGGTGATTGTCCTGGCCACATGTTCATCCTGGAATTGCTGGCGG

Full Affymetrix probeset data:

Annotations for 1636828_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720