Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636829_at:

>probe:Drosophila_2:1636829_at:580:325; Interrogation_Position=1044; Antisense; GCGAGCCCCATTCGAGGATTATCTG
>probe:Drosophila_2:1636829_at:404:631; Interrogation_Position=1096; Antisense; TCCTGCTTGATTGCCTGTGGTATTT
>probe:Drosophila_2:1636829_at:90:239; Interrogation_Position=1158; Antisense; AATAGTCCCTTTGTCTTCATGATTC
>probe:Drosophila_2:1636829_at:570:397; Interrogation_Position=1191; Antisense; GACAACATATATTTCCGTGGCCGAG
>probe:Drosophila_2:1636829_at:507:577; Interrogation_Position=1209; Antisense; GGCCGAGTCGTTGATCCTTTGAAGA
>probe:Drosophila_2:1636829_at:10:361; Interrogation_Position=1237; Antisense; GCAATCCCATTGACCGTATAACCAT
>probe:Drosophila_2:1636829_at:720:537; Interrogation_Position=695; Antisense; GGTAATCGTTCTGCCCAAGGACAAT
>probe:Drosophila_2:1636829_at:624:229; Interrogation_Position=717; Antisense; AATGGGTCCCTAACTCAGGCAGAAG
>probe:Drosophila_2:1636829_at:523:217; Interrogation_Position=752; Antisense; AAGTTACCCTCAGATAGTTCTCACT
>probe:Drosophila_2:1636829_at:61:443; Interrogation_Position=783; Antisense; GATGTACATGTGCAGCTTCCTAAAT
>probe:Drosophila_2:1636829_at:163:237; Interrogation_Position=812; Antisense; AATCGATTTCCGCATGGAGCTCGTC
>probe:Drosophila_2:1636829_at:652:87; Interrogation_Position=855; Antisense; AGTAGATTCTGCTCACCTTATTTAA
>probe:Drosophila_2:1636829_at:117:79; Interrogation_Position=916; Antisense; AGGATCTCTTCAATAGTTCGTCGGA
>probe:Drosophila_2:1636829_at:708:91; Interrogation_Position=930; Antisense; AGTTCGTCGGATATCAGCGTCCTAC

Paste this into a BLAST search page for me
GCGAGCCCCATTCGAGGATTATCTGTCCTGCTTGATTGCCTGTGGTATTTAATAGTCCCTTTGTCTTCATGATTCGACAACATATATTTCCGTGGCCGAGGGCCGAGTCGTTGATCCTTTGAAGAGCAATCCCATTGACCGTATAACCATGGTAATCGTTCTGCCCAAGGACAATAATGGGTCCCTAACTCAGGCAGAAGAAGTTACCCTCAGATAGTTCTCACTGATGTACATGTGCAGCTTCCTAAATAATCGATTTCCGCATGGAGCTCGTCAGTAGATTCTGCTCACCTTATTTAAAGGATCTCTTCAATAGTTCGTCGGAAGTTCGTCGGATATCAGCGTCCTAC

Full Affymetrix probeset data:

Annotations for 1636829_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime