FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636833_at:

>probe:Drosophila_2:1636833_at:371:17; Interrogation_Position=2101; Antisense; ATTTTTACCATCTATTGTTCTGTGA
>probe:Drosophila_2:1636833_at:516:687; Interrogation_Position=2153; Antisense; TATATCGCAAATAATGTCCTTACAT
>probe:Drosophila_2:1636833_at:529:57; Interrogation_Position=2331; Antisense; ATGTTTTATTGTTCATGACCCGGAA
>probe:Drosophila_2:1636833_at:148:621; Interrogation_Position=2360; Antisense; TCGAAAACGGAATACATTGTGGCTC
>probe:Drosophila_2:1636833_at:148:275; Interrogation_Position=2374; Antisense; CATTGTGGCTCATTTACATTGTTCA
>probe:Drosophila_2:1636833_at:498:149; Interrogation_Position=2389; Antisense; ACATTGTTCAAATGAATTTCGCCCC
>probe:Drosophila_2:1636833_at:469:301; Interrogation_Position=2413; Antisense; CCCCTTGCATAGTTATCAGAATTCG
>probe:Drosophila_2:1636833_at:461:35; Interrogation_Position=2445; Antisense; ATCATGTCTCATGTGCCATAATTAA
>probe:Drosophila_2:1636833_at:231:235; Interrogation_Position=2469; Antisense; AATCGCGCAAATTGAGTTATTCACG
>probe:Drosophila_2:1636833_at:613:429; Interrogation_Position=2482; Antisense; GAGTTATTCACGTAATCATGTATCG
>probe:Drosophila_2:1636833_at:474:483; Interrogation_Position=2501; Antisense; GTATCGTTAATTCAGCTCAGTTTAT
>probe:Drosophila_2:1636833_at:89:491; Interrogation_Position=2548; Antisense; GTACATTGGCGTTGGTTAAACCTGT
>probe:Drosophila_2:1636833_at:124:303; Interrogation_Position=2574; Antisense; CCCCTGCTTGTCTAATTAGTGTTTA
>probe:Drosophila_2:1636833_at:519:395; Interrogation_Position=2603; Antisense; GACAACTCTGTCTAGTTAAAAACGA

Paste this into a BLAST search page for me
ATTTTTACCATCTATTGTTCTGTGATATATCGCAAATAATGTCCTTACATATGTTTTATTGTTCATGACCCGGAATCGAAAACGGAATACATTGTGGCTCCATTGTGGCTCATTTACATTGTTCAACATTGTTCAAATGAATTTCGCCCCCCCCTTGCATAGTTATCAGAATTCGATCATGTCTCATGTGCCATAATTAAAATCGCGCAAATTGAGTTATTCACGGAGTTATTCACGTAATCATGTATCGGTATCGTTAATTCAGCTCAGTTTATGTACATTGGCGTTGGTTAAACCTGTCCCCTGCTTGTCTAATTAGTGTTTAGACAACTCTGTCTAGTTAAAAACGA

Full Affymetrix probeset data:

Annotations for 1636833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720