Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636834_at:

>probe:Drosophila_2:1636834_at:725:453; Interrogation_Position=123; Antisense; GATAAACTCGGAGCTGCGGTCTCAG
>probe:Drosophila_2:1636834_at:586:605; Interrogation_Position=176; Antisense; TGATCCAGCTCTACCGGCTGAAGAA
>probe:Drosophila_2:1636834_at:61:263; Interrogation_Position=236; Antisense; CAGCCAGTGCTATTCTCTCGAGGAG
>probe:Drosophila_2:1636834_at:380:423; Interrogation_Position=268; Antisense; GAGAAATCTCATGAGTCCGCGGCTA
>probe:Drosophila_2:1636834_at:123:433; Interrogation_Position=280; Antisense; GAGTCCGCGGCTAGTGTGTCCACAA
>probe:Drosophila_2:1636834_at:41:599; Interrogation_Position=296; Antisense; TGTCCACAACACAATCCTCGGAGGA
>probe:Drosophila_2:1636834_at:501:421; Interrogation_Position=319; Antisense; GAGCAAGAATCAACCACTAGCGCAG
>probe:Drosophila_2:1636834_at:63:469; Interrogation_Position=382; Antisense; GTTGAGTCCAATTCTTCCGACGATA
>probe:Drosophila_2:1636834_at:97:139; Interrogation_Position=401; Antisense; ACGATACACTTTTCTCCGATGACTA
>probe:Drosophila_2:1636834_at:80:671; Interrogation_Position=424; Antisense; TACGATCCCAGCTCGAATCTGAGTT
>probe:Drosophila_2:1636834_at:65:585; Interrogation_Position=462; Antisense; TGGAACGCGGCTACCGAATGTCCAA
>probe:Drosophila_2:1636834_at:572:169; Interrogation_Position=497; Antisense; AAAGGCGCCAGTTTGTGCATCTAAA
>probe:Drosophila_2:1636834_at:661:117; Interrogation_Position=528; Antisense; AGCTATGGCCATTTATCTGGCGGGA
>probe:Drosophila_2:1636834_at:715:493; Interrogation_Position=85; Antisense; GTAATCAGAAATCCGCACCTGCTGA

Paste this into a BLAST search page for me
GATAAACTCGGAGCTGCGGTCTCAGTGATCCAGCTCTACCGGCTGAAGAACAGCCAGTGCTATTCTCTCGAGGAGGAGAAATCTCATGAGTCCGCGGCTAGAGTCCGCGGCTAGTGTGTCCACAATGTCCACAACACAATCCTCGGAGGAGAGCAAGAATCAACCACTAGCGCAGGTTGAGTCCAATTCTTCCGACGATAACGATACACTTTTCTCCGATGACTATACGATCCCAGCTCGAATCTGAGTTTGGAACGCGGCTACCGAATGTCCAAAAAGGCGCCAGTTTGTGCATCTAAAAGCTATGGCCATTTATCTGGCGGGAGTAATCAGAAATCCGCACCTGCTGA

Full Affymetrix probeset data:

Annotations for 1636834_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime