Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636835_at:

>probe:Drosophila_2:1636835_at:683:457; Interrogation_Position=1851; Antisense; GATTTTAGCGGAACTACTGATTTTT
>probe:Drosophila_2:1636835_at:83:177; Interrogation_Position=1878; Antisense; AAACGCCAAAATTCCCATATCATAT
>probe:Drosophila_2:1636835_at:481:189; Interrogation_Position=1907; Antisense; AACATACTCAGGACTCCGGCTTGAA
>probe:Drosophila_2:1636835_at:672:389; Interrogation_Position=1983; Antisense; GAAACACAACTATTAACGATCTCCG
>probe:Drosophila_2:1636835_at:200:453; Interrogation_Position=2000; Antisense; GATCTCCGAGTTTTTGAGATGCCAA
>probe:Drosophila_2:1636835_at:359:237; Interrogation_Position=2024; Antisense; AATCAGTTGGGATGCCTTACACGAA
>probe:Drosophila_2:1636835_at:357:359; Interrogation_Position=2144; Antisense; GCAACCATTTAACAGCCATCATTTT
>probe:Drosophila_2:1636835_at:385:219; Interrogation_Position=2206; Antisense; AATGTACCCACTCTTAATCCTTAAT
>probe:Drosophila_2:1636835_at:471:387; Interrogation_Position=2240; Antisense; GAAAACCCAATATGCTTGCGAATTT
>probe:Drosophila_2:1636835_at:659:15; Interrogation_Position=2302; Antisense; ATTTATTTATACCTAAGTGCCTTCT
>probe:Drosophila_2:1636835_at:199:87; Interrogation_Position=2317; Antisense; AGTGCCTTCTTTTGTGTCTTAGTAA
>probe:Drosophila_2:1636835_at:109:207; Interrogation_Position=2340; Antisense; AAGCGTGTAGCGCATTTTACCTACT
>probe:Drosophila_2:1636835_at:497:179; Interrogation_Position=2403; Antisense; AAACAATGCGACGTTCGTTTTGACG
>probe:Drosophila_2:1636835_at:482:471; Interrogation_Position=2415; Antisense; GTTCGTTTTGACGTCATCGCAACAT

Paste this into a BLAST search page for me
GATTTTAGCGGAACTACTGATTTTTAAACGCCAAAATTCCCATATCATATAACATACTCAGGACTCCGGCTTGAAGAAACACAACTATTAACGATCTCCGGATCTCCGAGTTTTTGAGATGCCAAAATCAGTTGGGATGCCTTACACGAAGCAACCATTTAACAGCCATCATTTTAATGTACCCACTCTTAATCCTTAATGAAAACCCAATATGCTTGCGAATTTATTTATTTATACCTAAGTGCCTTCTAGTGCCTTCTTTTGTGTCTTAGTAAAAGCGTGTAGCGCATTTTACCTACTAAACAATGCGACGTTCGTTTTGACGGTTCGTTTTGACGTCATCGCAACAT

Full Affymetrix probeset data:

Annotations for 1636835_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime