Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636836_at:

>probe:Drosophila_2:1636836_at:589:179; Interrogation_Position=2071; Antisense; AAAAGTCCGAAGAGGGCGTGCAGAA
>probe:Drosophila_2:1636836_at:329:235; Interrogation_Position=2148; Antisense; AATCCAAATGACACAGCCGCTGAAG
>probe:Drosophila_2:1636836_at:190:411; Interrogation_Position=2286; Antisense; GACGCTGCTGAAGAATCCGCTGAAG
>probe:Drosophila_2:1636836_at:483:45; Interrogation_Position=2300; Antisense; ATCCGCTGAAGCAGCAAAGCCCGAA
>probe:Drosophila_2:1636836_at:501:357; Interrogation_Position=2313; Antisense; GCAAAGCCCGAAGAAAGCGCTGTGA
>probe:Drosophila_2:1636836_at:46:391; Interrogation_Position=2325; Antisense; GAAAGCGCTGTGAAAATTGATGAAA
>probe:Drosophila_2:1636836_at:94:227; Interrogation_Position=2355; Antisense; AATGGCTATGAAAATGCCTATGCAA
>probe:Drosophila_2:1636836_at:245:585; Interrogation_Position=2411; Antisense; TGGAAATGCAAATGCGACGCCGGCA
>probe:Drosophila_2:1636836_at:203:351; Interrogation_Position=2433; Antisense; GCAGCGAAGTCGTTGTCCCGACGTC
>probe:Drosophila_2:1636836_at:383:605; Interrogation_Position=2491; Antisense; TGAGGAAACACCATTAGGCCCCACT
>probe:Drosophila_2:1636836_at:113:301; Interrogation_Position=2509; Antisense; CCCCACTCCTTAGCTTAATTTATTG
>probe:Drosophila_2:1636836_at:140:657; Interrogation_Position=2559; Antisense; TAATGCTAAACGTTGAAGCCTGTTA
>probe:Drosophila_2:1636836_at:260:379; Interrogation_Position=2573; Antisense; GAAGCCTGTTAATTAATACGTATTT
>probe:Drosophila_2:1636836_at:671:391; Interrogation_Position=2610; Antisense; GAAACCAACTCAAAGCCAAACTCAA

Paste this into a BLAST search page for me
AAAAGTCCGAAGAGGGCGTGCAGAAAATCCAAATGACACAGCCGCTGAAGGACGCTGCTGAAGAATCCGCTGAAGATCCGCTGAAGCAGCAAAGCCCGAAGCAAAGCCCGAAGAAAGCGCTGTGAGAAAGCGCTGTGAAAATTGATGAAAAATGGCTATGAAAATGCCTATGCAATGGAAATGCAAATGCGACGCCGGCAGCAGCGAAGTCGTTGTCCCGACGTCTGAGGAAACACCATTAGGCCCCACTCCCCACTCCTTAGCTTAATTTATTGTAATGCTAAACGTTGAAGCCTGTTAGAAGCCTGTTAATTAATACGTATTTGAAACCAACTCAAAGCCAAACTCAA

Full Affymetrix probeset data:

Annotations for 1636836_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime