FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636837_at:

>probe:Drosophila_2:1636837_at:57:247; Interrogation_Position=1523; Antisense; AATTCGATTTCGAGAGCTATCCGAG
>probe:Drosophila_2:1636837_at:367:341; Interrogation_Position=1538; Antisense; GCTATCCGAGTTGTGGGTTATCATT
>probe:Drosophila_2:1636837_at:151:227; Interrogation_Position=1616; Antisense; AAGGCGAATGCATCTTCGCATCTGC
>probe:Drosophila_2:1636837_at:303:243; Interrogation_Position=1695; Antisense; AATATCTCACCCTAATTGATCCCTC
>probe:Drosophila_2:1636837_at:21:253; Interrogation_Position=1730; Antisense; CAAAATCTCCCTAGGCCTTTTAGTG
>probe:Drosophila_2:1636837_at:230:677; Interrogation_Position=1741; Antisense; TAGGCCTTTTAGTGGCGCCCATGCA
>probe:Drosophila_2:1636837_at:363:581; Interrogation_Position=1753; Antisense; TGGCGCCCATGCACTTGAAACAAAG
>probe:Drosophila_2:1636837_at:668:427; Interrogation_Position=1826; Antisense; GAGATAGAAAAGTATGCCACCCATA
>probe:Drosophila_2:1636837_at:287:49; Interrogation_Position=1839; Antisense; ATGCCACCCATATCTTTTGTTGAGC
>probe:Drosophila_2:1636837_at:244:725; Interrogation_Position=1858; Antisense; TTGAGCCCATTTTACGCTGTGGTAC
>probe:Drosophila_2:1636837_at:419:653; Interrogation_Position=1888; Antisense; TAATTAACTACACAAGAGCCAGCAG
>probe:Drosophila_2:1636837_at:50:149; Interrogation_Position=1986; Antisense; ACTATGTTTAATCCCTTTGTATGTA
>probe:Drosophila_2:1636837_at:428:101; Interrogation_Position=2044; Antisense; AGAGTCGCATTATCTGCGCCAGTTT
>probe:Drosophila_2:1636837_at:164:323; Interrogation_Position=2059; Antisense; GCGCCAGTTTTATGCAAATTCAATA

Paste this into a BLAST search page for me
AATTCGATTTCGAGAGCTATCCGAGGCTATCCGAGTTGTGGGTTATCATTAAGGCGAATGCATCTTCGCATCTGCAATATCTCACCCTAATTGATCCCTCCAAAATCTCCCTAGGCCTTTTAGTGTAGGCCTTTTAGTGGCGCCCATGCATGGCGCCCATGCACTTGAAACAAAGGAGATAGAAAAGTATGCCACCCATAATGCCACCCATATCTTTTGTTGAGCTTGAGCCCATTTTACGCTGTGGTACTAATTAACTACACAAGAGCCAGCAGACTATGTTTAATCCCTTTGTATGTAAGAGTCGCATTATCTGCGCCAGTTTGCGCCAGTTTTATGCAAATTCAATA

Full Affymetrix probeset data:

Annotations for 1636837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720