Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636838_a_at:

>probe:Drosophila_2:1636838_a_at:228:33; Interrogation_Position=1004; Antisense; ATCACGGCGGCGTGTAAGCAATCCC
>probe:Drosophila_2:1636838_a_at:27:235; Interrogation_Position=1023; Antisense; AATCCCGCTGCCAGGACGAAAGTTT
>probe:Drosophila_2:1636838_a_at:648:171; Interrogation_Position=1041; Antisense; AAAGTTTCTCGATTAGTGTGCTCCT
>probe:Drosophila_2:1636838_a_at:146:83; Interrogation_Position=1055; Antisense; AGTGTGCTCCTTCAGCGGGCGAAAA
>probe:Drosophila_2:1636838_a_at:4:5; Interrogation_Position=544; Antisense; ATTGTGGGCGGACCACACAATCCGC
>probe:Drosophila_2:1636838_a_at:375:97; Interrogation_Position=572; Antisense; AGATCGCGGCACAGAAGCGTCTGCA
>probe:Drosophila_2:1636838_a_at:221:57; Interrogation_Position=617; Antisense; ATGAGGTCGTGGACATCATGCGCAC
>probe:Drosophila_2:1636838_a_at:343:413; Interrogation_Position=691; Antisense; GACCGTGCCGATGCCTTGCAGCAGG
>probe:Drosophila_2:1636838_a_at:522:81; Interrogation_Position=713; Antisense; AGGGTGCCTCGCAGTTTGAGCAGCA
>probe:Drosophila_2:1636838_a_at:118:119; Interrogation_Position=746; Antisense; AGCTCAAGAGGAAATTCTGGCTTCA
>probe:Drosophila_2:1636838_a_at:230:647; Interrogation_Position=788; Antisense; TCATCATGGGCGTGATTGGCCTGGT
>probe:Drosophila_2:1636838_a_at:428:305; Interrogation_Position=807; Antisense; CCTGGTTGTCGTGGGCATTATTGCA
>probe:Drosophila_2:1636838_a_at:410:113; Interrogation_Position=917; Antisense; AGCAGCCAGCCGGAGGACAGTCATC
>probe:Drosophila_2:1636838_a_at:313:155; Interrogation_Position=933; Antisense; ACAGTCATCGCTGGTGGATGCGGCA

Paste this into a BLAST search page for me
ATCACGGCGGCGTGTAAGCAATCCCAATCCCGCTGCCAGGACGAAAGTTTAAAGTTTCTCGATTAGTGTGCTCCTAGTGTGCTCCTTCAGCGGGCGAAAAATTGTGGGCGGACCACACAATCCGCAGATCGCGGCACAGAAGCGTCTGCAATGAGGTCGTGGACATCATGCGCACGACCGTGCCGATGCCTTGCAGCAGGAGGGTGCCTCGCAGTTTGAGCAGCAAGCTCAAGAGGAAATTCTGGCTTCATCATCATGGGCGTGATTGGCCTGGTCCTGGTTGTCGTGGGCATTATTGCAAGCAGCCAGCCGGAGGACAGTCATCACAGTCATCGCTGGTGGATGCGGCA

Full Affymetrix probeset data:

Annotations for 1636838_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime