Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636839_a_at:

>probe:Drosophila_2:1636839_a_at:112:485; Interrogation_Position=387; Antisense; GTATGCATTCATCTATCAGGCCACA
>probe:Drosophila_2:1636839_a_at:508:159; Interrogation_Position=409; Antisense; ACAACCATTCCTATTGCCTGTGCTT
>probe:Drosophila_2:1636839_a_at:144:285; Interrogation_Position=426; Antisense; CTGTGCTTGCAACGTAACCATGGAC
>probe:Drosophila_2:1636839_a_at:726:605; Interrogation_Position=467; Antisense; TGATGCTGCATCTGTCCTTGTGTTT
>probe:Drosophila_2:1636839_a_at:48:603; Interrogation_Position=487; Antisense; TGTTTGCGTATGTTGGGCCAGCGAT
>probe:Drosophila_2:1636839_a_at:619:187; Interrogation_Position=590; Antisense; AACAGGCCTTGAGCATTGAAATCTT
>probe:Drosophila_2:1636839_a_at:389:19; Interrogation_Position=616; Antisense; ATTTCGAAGAGCACGTTCACCCAAA
>probe:Drosophila_2:1636839_a_at:368:245; Interrogation_Position=639; Antisense; AATTCTGGTCAGTTCCCTTATCATT
>probe:Drosophila_2:1636839_a_at:358:307; Interrogation_Position=654; Antisense; CCTTATCATTTGCTTCACCATTTAC
>probe:Drosophila_2:1636839_a_at:490:495; Interrogation_Position=723; Antisense; GTCATGCTGCCCACCATATATGGTA
>probe:Drosophila_2:1636839_a_at:254:201; Interrogation_Position=747; Antisense; AACGCCGTCATCGATTCTGCAAATA
>probe:Drosophila_2:1636839_a_at:69:681; Interrogation_Position=770; Antisense; TATGTTGACCGATTCCATGTACAAT
>probe:Drosophila_2:1636839_a_at:47:369; Interrogation_Position=820; Antisense; GAATGCGTCGCCTAGTTTTAATGTT
>probe:Drosophila_2:1636839_a_at:409:599; Interrogation_Position=850; Antisense; TGTACTTAAATCGACCGGTGACCTT

Paste this into a BLAST search page for me
GTATGCATTCATCTATCAGGCCACAACAACCATTCCTATTGCCTGTGCTTCTGTGCTTGCAACGTAACCATGGACTGATGCTGCATCTGTCCTTGTGTTTTGTTTGCGTATGTTGGGCCAGCGATAACAGGCCTTGAGCATTGAAATCTTATTTCGAAGAGCACGTTCACCCAAAAATTCTGGTCAGTTCCCTTATCATTCCTTATCATTTGCTTCACCATTTACGTCATGCTGCCCACCATATATGGTAAACGCCGTCATCGATTCTGCAAATATATGTTGACCGATTCCATGTACAATGAATGCGTCGCCTAGTTTTAATGTTTGTACTTAAATCGACCGGTGACCTT

Full Affymetrix probeset data:

Annotations for 1636839_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime