FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636840_at:

>probe:Drosophila_2:1636840_at:139:461; Interrogation_Position=1604; Antisense; GATTATTTTCGGCAACACTTGTCCA
>probe:Drosophila_2:1636840_at:648:157; Interrogation_Position=1618; Antisense; ACACTTGTCCAGTTCGAAGCGCCAG
>probe:Drosophila_2:1636840_at:280:379; Interrogation_Position=1633; Antisense; GAAGCGCCAGCGCTCGACCTTTGAG
>probe:Drosophila_2:1636840_at:365:717; Interrogation_Position=1694; Antisense; TTGCGCAAGCACAACTTTAGTAATT
>probe:Drosophila_2:1636840_at:442:379; Interrogation_Position=1782; Antisense; GAACCAAGGGCAAACCATCATTAGA
>probe:Drosophila_2:1636840_at:673:457; Interrogation_Position=1821; Antisense; GATTTTTTGTCTACCTTAACTCGCT
>probe:Drosophila_2:1636840_at:213:231; Interrogation_Position=1858; Antisense; AATGTCGTGCAGTCGTCAATCGGCC
>probe:Drosophila_2:1636840_at:347:519; Interrogation_Position=1888; Antisense; GGGCGATGACCTCAAGCATTTCATT
>probe:Drosophila_2:1636840_at:62:17; Interrogation_Position=1905; Antisense; ATTTCATTTGCGACCGGATCCGGAA
>probe:Drosophila_2:1636840_at:332:47; Interrogation_Position=1922; Antisense; ATCCGGAAATTCGATCGCCTACGAC
>probe:Drosophila_2:1636840_at:31:421; Interrogation_Position=1969; Antisense; GAGAAGGCCCAAAAAGCTGGTCGAG
>probe:Drosophila_2:1636840_at:546:535; Interrogation_Position=1987; Antisense; GGTCGAGGATCAAATGCACCATTTA
>probe:Drosophila_2:1636840_at:293:419; Interrogation_Position=2028; Antisense; GAGCTACATACTATTCACGGTCACC
>probe:Drosophila_2:1636840_at:687:257; Interrogation_Position=2043; Antisense; CACGGTCACCCTATTTACCATATAA

Paste this into a BLAST search page for me
GATTATTTTCGGCAACACTTGTCCAACACTTGTCCAGTTCGAAGCGCCAGGAAGCGCCAGCGCTCGACCTTTGAGTTGCGCAAGCACAACTTTAGTAATTGAACCAAGGGCAAACCATCATTAGAGATTTTTTGTCTACCTTAACTCGCTAATGTCGTGCAGTCGTCAATCGGCCGGGCGATGACCTCAAGCATTTCATTATTTCATTTGCGACCGGATCCGGAAATCCGGAAATTCGATCGCCTACGACGAGAAGGCCCAAAAAGCTGGTCGAGGGTCGAGGATCAAATGCACCATTTAGAGCTACATACTATTCACGGTCACCCACGGTCACCCTATTTACCATATAA

Full Affymetrix probeset data:

Annotations for 1636840_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720