FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636841_at:

>probe:Drosophila_2:1636841_at:132:673; Interrogation_Position=2271; Antisense; TACCTTCCTTGTGGTGCATATCGCA
>probe:Drosophila_2:1636841_at:609:9; Interrogation_Position=2300; Antisense; ATTCCGATCGTGGTGTATTTCTAGT
>probe:Drosophila_2:1636841_at:691:585; Interrogation_Position=2384; Antisense; TGGAGAACCGACTATGCGATTTTTT
>probe:Drosophila_2:1636841_at:405:491; Interrogation_Position=2495; Antisense; GTAAGTGCCACAGAGTCCAATGACT
>probe:Drosophila_2:1636841_at:196:311; Interrogation_Position=2511; Antisense; CCAATGACTTGACCACATCCTTTAA
>probe:Drosophila_2:1636841_at:128:217; Interrogation_Position=2563; Antisense; AAGTTCTCAGCGAATGCGCCTCATA
>probe:Drosophila_2:1636841_at:536:497; Interrogation_Position=2659; Antisense; GTCTGCGGCTTAACTAGATTTCGTT
>probe:Drosophila_2:1636841_at:376:21; Interrogation_Position=2701; Antisense; ATATTGTGTCGACTTGCAAGGCCCC
>probe:Drosophila_2:1636841_at:346:615; Interrogation_Position=2715; Antisense; TGCAAGGCCCCATAGTGGCGAATAT
>probe:Drosophila_2:1636841_at:275:521; Interrogation_Position=2729; Antisense; GTGGCGAATATGTTTAGCCCCTTTC
>probe:Drosophila_2:1636841_at:724:719; Interrogation_Position=2765; Antisense; TTGCCACGATCCCAGAAGACCTAGG
>probe:Drosophila_2:1636841_at:405:209; Interrogation_Position=2780; Antisense; AAGACCTAGGGTTTAGCTTCTGGCT
>probe:Drosophila_2:1636841_at:11:677; Interrogation_Position=2793; Antisense; TAGCTTCTGGCTGGCGGTCAGACAA
>probe:Drosophila_2:1636841_at:234:395; Interrogation_Position=2813; Antisense; GACAACCTGGGCGAGGAAACCCTCA

Paste this into a BLAST search page for me
TACCTTCCTTGTGGTGCATATCGCAATTCCGATCGTGGTGTATTTCTAGTTGGAGAACCGACTATGCGATTTTTTGTAAGTGCCACAGAGTCCAATGACTCCAATGACTTGACCACATCCTTTAAAAGTTCTCAGCGAATGCGCCTCATAGTCTGCGGCTTAACTAGATTTCGTTATATTGTGTCGACTTGCAAGGCCCCTGCAAGGCCCCATAGTGGCGAATATGTGGCGAATATGTTTAGCCCCTTTCTTGCCACGATCCCAGAAGACCTAGGAAGACCTAGGGTTTAGCTTCTGGCTTAGCTTCTGGCTGGCGGTCAGACAAGACAACCTGGGCGAGGAAACCCTCA

Full Affymetrix probeset data:

Annotations for 1636841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720