FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636842_at:

>probe:Drosophila_2:1636842_at:631:129; Interrogation_Position=1088; Antisense; ACCTTCTCCCAGTACTTGGATCTAG
>probe:Drosophila_2:1636842_at:236:113; Interrogation_Position=1128; Antisense; AGCACCTAACTTACGATGAGCGGGA
>probe:Drosophila_2:1636842_at:381:177; Interrogation_Position=1177; Antisense; AAACGATGACGGTCGCCACATTGTC
>probe:Drosophila_2:1636842_at:417:5; Interrogation_Position=1196; Antisense; ATTGTCTTTTATCCCACTCTCTATT
>probe:Drosophila_2:1636842_at:33:595; Interrogation_Position=1254; Antisense; TGGGCACTGGCATTTCAATCTGGGA
>probe:Drosophila_2:1636842_at:517:235; Interrogation_Position=1270; Antisense; AATCTGGGAACTTGGCCAAGGCCTA
>probe:Drosophila_2:1636842_at:52:697; Interrogation_Position=1302; Antisense; TTTACGATCTCTTCTAGTTAGCCTG
>probe:Drosophila_2:1636842_at:289:173; Interrogation_Position=790; Antisense; AAAGCAACAGCTGCGACTCATTTTG
>probe:Drosophila_2:1636842_at:633:403; Interrogation_Position=804; Antisense; GACTCATTTTGGTCATTCCTCCATT
>probe:Drosophila_2:1636842_at:100:603; Interrogation_Position=876; Antisense; TGTTCAAGCACATATACGCCTTCTC
>probe:Drosophila_2:1636842_at:515:713; Interrogation_Position=896; Antisense; TTCTCTCTGATGACTTACGACTTCT
>probe:Drosophila_2:1636842_at:714:121; Interrogation_Position=930; Antisense; AGCGTCCCGGAGCAAATGCACCATT
>probe:Drosophila_2:1636842_at:537:53; Interrogation_Position=945; Antisense; ATGCACCATTATATTTCGTCCGTAA
>probe:Drosophila_2:1636842_at:607:371; Interrogation_Position=992; Antisense; GAAGGTTGCGCTGATATGACGGCTA

Paste this into a BLAST search page for me
ACCTTCTCCCAGTACTTGGATCTAGAGCACCTAACTTACGATGAGCGGGAAAACGATGACGGTCGCCACATTGTCATTGTCTTTTATCCCACTCTCTATTTGGGCACTGGCATTTCAATCTGGGAAATCTGGGAACTTGGCCAAGGCCTATTTACGATCTCTTCTAGTTAGCCTGAAAGCAACAGCTGCGACTCATTTTGGACTCATTTTGGTCATTCCTCCATTTGTTCAAGCACATATACGCCTTCTCTTCTCTCTGATGACTTACGACTTCTAGCGTCCCGGAGCAAATGCACCATTATGCACCATTATATTTCGTCCGTAAGAAGGTTGCGCTGATATGACGGCTA

Full Affymetrix probeset data:

Annotations for 1636842_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720