FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636844_at:

>probe:Drosophila_2:1636844_at:145:423; Interrogation_Position=1582; Antisense; GAGAATCACCTCAAAGTCCATCAGT
>probe:Drosophila_2:1636844_at:6:469; Interrogation_Position=1605; Antisense; GTTGCAGCACAAGATGGCCCAGCGG
>probe:Drosophila_2:1636844_at:580:251; Interrogation_Position=1633; Antisense; CAAGAGGCTGCTATTTTACCCCTAA
>probe:Drosophila_2:1636844_at:244:573; Interrogation_Position=1661; Antisense; TGGCCGAAAAGGCTCCAGTGGCTAT
>probe:Drosophila_2:1636844_at:379:55; Interrogation_Position=1684; Antisense; ATGACGGCTCCGCTAGTTCAGGATC
>probe:Drosophila_2:1636844_at:371:473; Interrogation_Position=1699; Antisense; GTTCAGGATCCCCAGCTAGTGCGTC
>probe:Drosophila_2:1636844_at:348:349; Interrogation_Position=1729; Antisense; GCAGCGGAACTGTCGTTCTACAGCA
>probe:Drosophila_2:1636844_at:427:471; Interrogation_Position=1743; Antisense; GTTCTACAGCAACATGATTCCCACA
>probe:Drosophila_2:1636844_at:613:53; Interrogation_Position=1768; Antisense; ATGAATCTGGGCTTCTACAGCGAGA
>probe:Drosophila_2:1636844_at:416:155; Interrogation_Position=1784; Antisense; ACAGCGAGACTCGTCCCGAGGAATA
>probe:Drosophila_2:1636844_at:659:71; Interrogation_Position=1864; Antisense; AGGTCAAGGCTGTTTTAGTCGTTCA
>probe:Drosophila_2:1636844_at:454:501; Interrogation_Position=1881; Antisense; GTCGTTCAGGTCAACATAGAATCCA
>probe:Drosophila_2:1636844_at:575:217; Interrogation_Position=1932; Antisense; AAGTCATCTGACTATTGTCTGCCAA
>probe:Drosophila_2:1636844_at:552:389; Interrogation_Position=1994; Antisense; GAAACGGTTTTCTTCGAGATCGTAT

Paste this into a BLAST search page for me
GAGAATCACCTCAAAGTCCATCAGTGTTGCAGCACAAGATGGCCCAGCGGCAAGAGGCTGCTATTTTACCCCTAATGGCCGAAAAGGCTCCAGTGGCTATATGACGGCTCCGCTAGTTCAGGATCGTTCAGGATCCCCAGCTAGTGCGTCGCAGCGGAACTGTCGTTCTACAGCAGTTCTACAGCAACATGATTCCCACAATGAATCTGGGCTTCTACAGCGAGAACAGCGAGACTCGTCCCGAGGAATAAGGTCAAGGCTGTTTTAGTCGTTCAGTCGTTCAGGTCAACATAGAATCCAAAGTCATCTGACTATTGTCTGCCAAGAAACGGTTTTCTTCGAGATCGTAT

Full Affymetrix probeset data:

Annotations for 1636844_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720