FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636845_at:

>probe:Drosophila_2:1636845_at:159:459; Interrogation_Position=466; Antisense; GATATTTGTCCCGATGAGCTAGAGA
>probe:Drosophila_2:1636845_at:182:215; Interrogation_Position=490; Antisense; AAGATGGCCGCCGTCGTCGATGAAG
>probe:Drosophila_2:1636845_at:139:613; Interrogation_Position=510; Antisense; TGAAGTTGAAAAGTCCCCGCAAACG
>probe:Drosophila_2:1636845_at:581:617; Interrogation_Position=542; Antisense; TGCAGCCCATCTTTATCACCGTTGA
>probe:Drosophila_2:1636845_at:78:467; Interrogation_Position=562; Antisense; GTTGACCCAGAACGTGACTCCAAAG
>probe:Drosophila_2:1636845_at:599:175; Interrogation_Position=622; Antisense; AAACTGCTGGGACTCACGGGAACCG
>probe:Drosophila_2:1636845_at:322:381; Interrogation_Position=641; Antisense; GAACCGTCGAACAAATCCGCAAAGT
>probe:Drosophila_2:1636845_at:158:633; Interrogation_Position=656; Antisense; TCCGCAAAGTGTGCAAGGCCTTCAG
>probe:Drosophila_2:1636845_at:122:71; Interrogation_Position=671; Antisense; AGGCCTTCAGGGTTTATTTCAGCGC
>probe:Drosophila_2:1636845_at:151:5; Interrogation_Position=724; Antisense; ATTGTGGATCACACCATCATCATGT
>probe:Drosophila_2:1636845_at:669:35; Interrogation_Position=739; Antisense; ATCATCATGTACCTGGTCAATCCCG
>probe:Drosophila_2:1636845_at:564:493; Interrogation_Position=754; Antisense; GTCAATCCCGATGGCGAGTTTGTCG
>probe:Drosophila_2:1636845_at:514:291; Interrogation_Position=768; Antisense; CGAGTTTGTCGATTACTACGGCCAA
>probe:Drosophila_2:1636845_at:647:73; Interrogation_Position=803; Antisense; AGGACCAGTGTGTGGCATCCATTTT

Paste this into a BLAST search page for me
GATATTTGTCCCGATGAGCTAGAGAAAGATGGCCGCCGTCGTCGATGAAGTGAAGTTGAAAAGTCCCCGCAAACGTGCAGCCCATCTTTATCACCGTTGAGTTGACCCAGAACGTGACTCCAAAGAAACTGCTGGGACTCACGGGAACCGGAACCGTCGAACAAATCCGCAAAGTTCCGCAAAGTGTGCAAGGCCTTCAGAGGCCTTCAGGGTTTATTTCAGCGCATTGTGGATCACACCATCATCATGTATCATCATGTACCTGGTCAATCCCGGTCAATCCCGATGGCGAGTTTGTCGCGAGTTTGTCGATTACTACGGCCAAAGGACCAGTGTGTGGCATCCATTTT

Full Affymetrix probeset data:

Annotations for 1636845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720