Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636846_at:

>probe:Drosophila_2:1636846_at:602:685; Interrogation_Position=3755; Antisense; TATACGCTGGTGTTTGAGCTAAACT
>probe:Drosophila_2:1636846_at:84:183; Interrogation_Position=3807; Antisense; AAAACTGCACTTACTGTCTACACGA
>probe:Drosophila_2:1636846_at:219:143; Interrogation_Position=3819; Antisense; ACTGTCTACACGACGCATGCGTTTA
>probe:Drosophila_2:1636846_at:625:347; Interrogation_Position=3833; Antisense; GCATGCGTTTAGAACTTGCAGAACT
>probe:Drosophila_2:1636846_at:390:247; Interrogation_Position=3871; Antisense; AATTGCGACCACTTGAATGAATCTA
>probe:Drosophila_2:1636846_at:88:401; Interrogation_Position=3911; Antisense; GACAGTGAGATATATTTGGCCGACA
>probe:Drosophila_2:1636846_at:622:579; Interrogation_Position=3927; Antisense; TGGCCGACAATTTGCAGAGAAGCTT
>probe:Drosophila_2:1636846_at:313:115; Interrogation_Position=3947; Antisense; AGCTTGCTTAGAGGGTTGGCTTACC
>probe:Drosophila_2:1636846_at:296:465; Interrogation_Position=3961; Antisense; GTTGGCTTACCAAATCGAATGTATC
>probe:Drosophila_2:1636846_at:340:203; Interrogation_Position=3994; Antisense; AACCATCGATCGTGCAATGCAGAAT
>probe:Drosophila_2:1636846_at:420:677; Interrogation_Position=4072; Antisense; TAGTTTGTGTACTCTCTCTCAACAG
>probe:Drosophila_2:1636846_at:259:281; Interrogation_Position=4087; Antisense; CTCTCAACAGAACCCCTATTACAAT
>probe:Drosophila_2:1636846_at:181:273; Interrogation_Position=4160; Antisense; CTTACAATTCGATCCAATCTCATGG
>probe:Drosophila_2:1636846_at:663:595; Interrogation_Position=4210; Antisense; TGTGCACACATTCTCATTAAATAGG

Paste this into a BLAST search page for me
TATACGCTGGTGTTTGAGCTAAACTAAAACTGCACTTACTGTCTACACGAACTGTCTACACGACGCATGCGTTTAGCATGCGTTTAGAACTTGCAGAACTAATTGCGACCACTTGAATGAATCTAGACAGTGAGATATATTTGGCCGACATGGCCGACAATTTGCAGAGAAGCTTAGCTTGCTTAGAGGGTTGGCTTACCGTTGGCTTACCAAATCGAATGTATCAACCATCGATCGTGCAATGCAGAATTAGTTTGTGTACTCTCTCTCAACAGCTCTCAACAGAACCCCTATTACAATCTTACAATTCGATCCAATCTCATGGTGTGCACACATTCTCATTAAATAGG

Full Affymetrix probeset data:

Annotations for 1636846_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime