Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636848_at:

>probe:Drosophila_2:1636848_at:327:443; Interrogation_Position=3562; Antisense; GATGTCAATCCATGTACGCGCTGAT
>probe:Drosophila_2:1636848_at:196:519; Interrogation_Position=3615; Antisense; GGGCCAAGGATACGTACCCTCGAAG
>probe:Drosophila_2:1636848_at:147:301; Interrogation_Position=3631; Antisense; CCCTCGAAGGATAACTATGGGCTTA
>probe:Drosophila_2:1636848_at:576:403; Interrogation_Position=3667; Antisense; GACTAGGTATACATACACCCGATGA
>probe:Drosophila_2:1636848_at:134:371; Interrogation_Position=3690; Antisense; GAAGAGCCACGGACAGTAAATCGTA
>probe:Drosophila_2:1636848_at:348:701; Interrogation_Position=3740; Antisense; TTTTGCCATAGAACCAATGCCGATT
>probe:Drosophila_2:1636848_at:478:233; Interrogation_Position=3755; Antisense; AATGCCGATTCGTAACTCCTCTAGG
>probe:Drosophila_2:1636848_at:623:527; Interrogation_Position=3778; Antisense; GGGAGTTTTCCCAATTCAGTTCATT
>probe:Drosophila_2:1636848_at:4:247; Interrogation_Position=3790; Antisense; AATTCAGTTCATTTACCCGCACGCA
>probe:Drosophila_2:1636848_at:705:671; Interrogation_Position=3803; Antisense; TACCCGCACGCATTCCAAAAACAGA
>probe:Drosophila_2:1636848_at:10:451; Interrogation_Position=3960; Antisense; GATCGCGTAAAGTAATGCTTAGCTT
>probe:Drosophila_2:1636848_at:177:295; Interrogation_Position=4036; Antisense; CGATGGCATCAAACACACAGATCAT
>probe:Drosophila_2:1636848_at:701:453; Interrogation_Position=4055; Antisense; GATCATCCACAGAACACATCAGACA
>probe:Drosophila_2:1636848_at:639:151; Interrogation_Position=4070; Antisense; ACATCAGACATCAGAACCATGCAGA

Paste this into a BLAST search page for me
GATGTCAATCCATGTACGCGCTGATGGGCCAAGGATACGTACCCTCGAAGCCCTCGAAGGATAACTATGGGCTTAGACTAGGTATACATACACCCGATGAGAAGAGCCACGGACAGTAAATCGTATTTTGCCATAGAACCAATGCCGATTAATGCCGATTCGTAACTCCTCTAGGGGGAGTTTTCCCAATTCAGTTCATTAATTCAGTTCATTTACCCGCACGCATACCCGCACGCATTCCAAAAACAGAGATCGCGTAAAGTAATGCTTAGCTTCGATGGCATCAAACACACAGATCATGATCATCCACAGAACACATCAGACAACATCAGACATCAGAACCATGCAGA

Full Affymetrix probeset data:

Annotations for 1636848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime