Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636849_at:

>probe:Drosophila_2:1636849_at:383:149; Interrogation_Position=5318; Antisense; ACTTCATGTCTTTGATGAGTCTGCT
>probe:Drosophila_2:1636849_at:719:57; Interrogation_Position=5332; Antisense; ATGAGTCTGCTCAAGTGCCGGATTT
>probe:Drosophila_2:1636849_at:167:507; Interrogation_Position=5346; Antisense; GTGCCGGATTTGACTCAGATAAACC
>probe:Drosophila_2:1636849_at:182:549; Interrogation_Position=5393; Antisense; GGAGACGGCGCCAAAAACCCGAGAG
>probe:Drosophila_2:1636849_at:648:265; Interrogation_Position=5440; Antisense; CAGATGTTTTGGCTGCAGTTGCTCT
>probe:Drosophila_2:1636849_at:178:587; Interrogation_Position=5471; Antisense; TGGAGTTCCTCATTCCGGTTTGAAA
>probe:Drosophila_2:1636849_at:144:169; Interrogation_Position=5495; Antisense; AAAGGAGGCGCTCAACATCGTTCTT
>probe:Drosophila_2:1636849_at:673:471; Interrogation_Position=5514; Antisense; GTTCTTATGCTGATCAAGCGGCTGA
>probe:Drosophila_2:1636849_at:199:561; Interrogation_Position=5547; Antisense; GGAAACGGAAACCAGCAGCCACTGA
>probe:Drosophila_2:1636849_at:532:113; Interrogation_Position=5560; Antisense; AGCAGCCACTGAGGTTGATCAAGCA
>probe:Drosophila_2:1636849_at:511:561; Interrogation_Position=5603; Antisense; GGAAAAGTTCCAGCGCGATTCGGCG
>probe:Drosophila_2:1636849_at:296:559; Interrogation_Position=5630; Antisense; GGAAATCCGGTGTCGCATCAAGGAC
>probe:Drosophila_2:1636849_at:357:517; Interrogation_Position=5724; Antisense; GTGTGTGGCCAAAAAATCTGCCTTG
>probe:Drosophila_2:1636849_at:345:587; Interrogation_Position=5840; Antisense; TGTGATTCATTGATCCAGGAGTGTA

Paste this into a BLAST search page for me
ACTTCATGTCTTTGATGAGTCTGCTATGAGTCTGCTCAAGTGCCGGATTTGTGCCGGATTTGACTCAGATAAACCGGAGACGGCGCCAAAAACCCGAGAGCAGATGTTTTGGCTGCAGTTGCTCTTGGAGTTCCTCATTCCGGTTTGAAAAAAGGAGGCGCTCAACATCGTTCTTGTTCTTATGCTGATCAAGCGGCTGAGGAAACGGAAACCAGCAGCCACTGAAGCAGCCACTGAGGTTGATCAAGCAGGAAAAGTTCCAGCGCGATTCGGCGGGAAATCCGGTGTCGCATCAAGGACGTGTGTGGCCAAAAAATCTGCCTTGTGTGATTCATTGATCCAGGAGTGTA

Full Affymetrix probeset data:

Annotations for 1636849_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime